\
| Variant ID: vg0141994613 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 41994613 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )
TACCAGACCATACCTCAATGGGAGTTTTCTTATTAAGTGGGATAGAAGGCGACCTGTTGATCAAGTAGCAGGCGGTGTTAGCAGCCTCTATCCAAAAACG[C/A]
TTGTTCATGCGAGCGTTGGACAGCATACAACGAGCCTTGGAGATGATGGTTCTGTTCATGCGCTCAGCCACACCATTCTGCTGTGGAGTGTACGGGATGG
CCATCCCGTACACTCCACAGCAGAATGGTGTGGCTGAGCGCATGAACAGAACCATCATCTCCAAGGCTCGTTGTATGCTGTCCAACGCTCGCATGAACAA[G/T]
CGTTTTTGGATAGAGGCTGCTAACACCGCCTGCTACTTGATCAACAGGTCGCCTTCTATCCCACTTAATAAGAAAACTCCCATTGAGGTATGGTCTGGTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.10% | 15.70% | 4.80% | 0.34% | NA |
| All Indica | 2759 | 66.70% | 26.40% | 6.85% | 0.04% | NA |
| All Japonica | 1512 | 96.60% | 0.30% | 2.25% | 0.93% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 88.60% | 0.00% | 11.43% | 0.00% | NA |
| Indica II | 465 | 30.30% | 66.50% | 3.23% | 0.00% | NA |
| Indica III | 913 | 68.20% | 25.00% | 6.68% | 0.11% | NA |
| Indica Intermediate | 786 | 69.80% | 24.40% | 5.73% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.30% | 0.20% | 6.75% | 2.78% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 11.10% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0141994613 | C -> A | LOC_Os01g72400.1 | missense_variant ; p.Lys611Asn; MODERATE | nonsynonymous_codon ; K611N | Average:18.002; most accessible tissue: Zhenshan97 panicle, score: 28.447 | benign |
0.747 |
DELETERIOUS | 0.03 |
| vg0141994613 | C -> DEL | LOC_Os01g72400.1 | N | frameshift_variant | Average:18.002; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0141994613 | NA | 2.51E-07 | Grain_thickness | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0141994613 | NA | 6.19E-12 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0141994613 | NA | 2.50E-06 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141994613 | NA | 6.85E-06 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141994613 | NA | 2.36E-06 | mr1629 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141994613 | NA | 3.83E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141994613 | 2.78E-06 | 2.78E-06 | mr1666 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141994613 | NA | 6.39E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141994613 | NA | 2.95E-07 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141994613 | NA | 1.07E-08 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141994613 | NA | 1.71E-06 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141994613 | NA | 5.03E-06 | mr1974 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141994613 | NA | 6.96E-06 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |