\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141990004:

Variant ID: vg0141990004 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41990004
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


ATGACTCTGACCACCTTTATGACAATGACCGGTTACATCTCACCAAGCTCTTGCCACCATTGACTCCGCCTTCTTATCTCGGATGAAGGCCATCGAGTGC[T/C]
TGGCATCTAGCCCTTGTTCCCTCAAGTGTCCACATTGCCAGAAGCCTTCATCTGCACCAAGCCCACTATGAGGCTTCGTCCGTGGTGGGCTGTAAGTAGA

Reverse complement sequence

TCTACTTACAGCCCACCACGGACGAAGCCTCATAGTGGGCTTGGTGCAGATGAAGGCTTCTGGCAATGTGGACACTTGAGGGAACAAGGGCTAGATGCCA[A/G]
GCACTCGATGGCCTTCATCCGAGATAAGAAGGCGGAGTCAATGGTGGCAAGAGCTTGGTGAGATGTAACCGGTCATTGTCATAAAGGTGGTCAGAGTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 31.80% 0.38% 14.11% NA
All Indica  2759 52.00% 25.80% 0.62% 21.49% NA
All Japonica  1512 51.10% 44.70% 0.00% 4.17% NA
Aus  269 67.30% 31.60% 0.37% 0.74% NA
Indica I  595 27.20% 42.90% 0.67% 29.24% NA
Indica II  465 78.30% 11.80% 0.65% 9.25% NA
Indica III  913 58.10% 18.30% 0.55% 23.11% NA
Indica Intermediate  786 48.30% 30.00% 0.64% 20.99% NA
Temperate Japonica  767 20.10% 79.90% 0.00% 0.00% NA
Tropical Japonica  504 85.50% 2.20% 0.00% 12.30% NA
Japonica Intermediate  241 78.00% 21.60% 0.00% 0.41% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 62.20% 27.80% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141990004 T -> DEL N N silent_mutation Average:56.456; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0141990004 T -> C LOC_Os01g72390.1 upstream_gene_variant ; 1148.0bp to feature; MODIFIER silent_mutation Average:56.456; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0141990004 T -> C LOC_Os01g72380.1 downstream_gene_variant ; 4960.0bp to feature; MODIFIER silent_mutation Average:56.456; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0141990004 T -> C LOC_Os01g72400.1 downstream_gene_variant ; 2473.0bp to feature; MODIFIER silent_mutation Average:56.456; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N
vg0141990004 T -> C LOC_Os01g72390-LOC_Os01g72400 intergenic_region ; MODIFIER silent_mutation Average:56.456; most accessible tissue: Minghui63 panicle, score: 78.92 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141990004 NA 3.08E-08 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 6.81E-06 mr1042 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 1.05E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 2.71E-06 mr1136 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 2.77E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 8.23E-08 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 6.69E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 1.76E-06 1.05E-08 mr1291 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 1.11E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 1.67E-06 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 2.00E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 3.54E-10 mr1502 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 7.13E-06 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 5.10E-10 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 1.01E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 2.85E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 3.87E-08 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 5.25E-07 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 1.97E-06 mr1725 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 1.73E-07 mr1729 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 7.23E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 9.64E-08 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 6.28E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 2.80E-06 mr1919 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 3.99E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 5.52E-07 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 6.20E-06 mr1975 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 3.99E-06 mr1990 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 2.60E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 7.79E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 7.28E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141990004 NA 7.74E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251