\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141981632:

Variant ID: vg0141981632 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41981632
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.84, G: 0.16, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AGTCAGAACAGGGAAGCCGCATCCTTCTGCATCCCGGGCACCTCCGGATCTACCGACAATTTTTTTTGCCTCGCCACGTAGAACATTTGAACGCATGTAC[A/G]
AAGTATTAAATGTGGACGAAAAAAAACAATTACACAGTTTGGGTGTAAATTGCGAGACGAATCTTTTAAGCTTAATTATGTCATGATCTGACAATGTGGT

Reverse complement sequence

ACCACATTGTCAGATCATGACATAATTAAGCTTAAAAGATTCGTCTCGCAATTTACACCCAAACTGTGTAATTGTTTTTTTTCGTCCACATTTAATACTT[T/C]
GTACATGCGTTCAAATGTTCTACGTGGCGAGGCAAAAAAAATTGTCGGTAGATCCGGAGGTGCCCGGGATGCAGAAGGATGCGGCTTCCCTGTTCTGACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.00% 39.70% 0.25% 0.04% NA
All Indica  2759 38.90% 60.70% 0.40% 0.04% NA
All Japonica  1512 94.80% 5.20% 0.00% 0.07% NA
Aus  269 64.30% 35.70% 0.00% 0.00% NA
Indica I  595 60.50% 39.20% 0.34% 0.00% NA
Indica II  465 15.70% 83.40% 0.65% 0.22% NA
Indica III  913 31.90% 67.90% 0.22% 0.00% NA
Indica Intermediate  786 44.40% 55.10% 0.51% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 85.30% 14.50% 0.00% 0.20% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141981632 A -> G LOC_Os01g72370.1 upstream_gene_variant ; 3224.0bp to feature; MODIFIER silent_mutation Average:83.428; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N
vg0141981632 A -> G LOC_Os01g72380.1 upstream_gene_variant ; 484.0bp to feature; MODIFIER silent_mutation Average:83.428; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N
vg0141981632 A -> G LOC_Os01g72370.3 upstream_gene_variant ; 3224.0bp to feature; MODIFIER silent_mutation Average:83.428; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N
vg0141981632 A -> G LOC_Os01g72370.2 upstream_gene_variant ; 3224.0bp to feature; MODIFIER silent_mutation Average:83.428; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N
vg0141981632 A -> G LOC_Os01g72390.1 downstream_gene_variant ; 4446.0bp to feature; MODIFIER silent_mutation Average:83.428; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N
vg0141981632 A -> G LOC_Os01g72370-LOC_Os01g72380 intergenic_region ; MODIFIER silent_mutation Average:83.428; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N
vg0141981632 A -> DEL N N silent_mutation Average:83.428; most accessible tissue: Minghui63 flag leaf, score: 91.207 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0141981632 A G 0.0 0.0 0.0 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141981632 NA 6.96E-06 mr1003 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 9.94E-08 mr1010 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 1.38E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 8.14E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 2.04E-06 mr1051 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 2.77E-08 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 8.76E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 9.60E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 1.31E-06 mr1274_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 1.85E-12 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 2.86E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 3.37E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 2.18E-08 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 1.99E-06 mr1474_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 9.59E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141981632 NA 1.08E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251