Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141975851:

Variant ID: vg0141975851 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41975851
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.84, T: 0.16, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

TTCACAAAATGCTGGGCACTCCTCGTTGATCGTTCCTTCACTTCTCTGTTTCAACATTAGATACATATATATAAATGAAAACTGTGAGTAATTTTCAGAA[C/T]
ACCGAACTTCTATGACAACTAAATAACGGTCTAATTGTACGCTATATATACACACAAACATGCTCTACTGTCAATTTTAACCCAAACAAGGAGAAACTTT

Reverse complement sequence

AAAGTTTCTCCTTGTTTGGGTTAAAATTGACAGTAGAGCATGTTTGTGTGTATATATAGCGTACAATTAGACCGTTATTTAGTTGTCATAGAAGTTCGGT[G/A]
TTCTGAAAATTACTCACAGTTTTCATTTATATATATGTATCTAATGTTGAAACAGAGAAGTGAAGGAACGATCAACGAGGAGTGCCCAGCATTTTGTGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.70%	10.20%	0.04%	0.00%	NA
All Indica	2759	84.90%	15.00%	0.07%	0.00%	NA
All Japonica	1512	95.80%	4.20%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	81.50%	18.50%	0.00%	0.00%	NA
Indica II	465	89.20%	10.80%	0.00%	0.00%	NA
Indica III	913	87.10%	12.90%	0.00%	0.00%	NA
Indica Intermediate	786	82.30%	17.40%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	87.90%	12.10%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141975851	C -> T	LOC_Os01g72360.1	downstream_gene_variant ; 2828.0bp to feature; MODIFIER	silent_mutation	Average:40.346; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N
vg0141975851	C -> T	LOC_Os01g72370.1	intron_variant ; MODIFIER	silent_mutation	Average:40.346; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N
vg0141975851	C -> T	LOC_Os01g72370.3	intron_variant ; MODIFIER	silent_mutation	Average:40.346; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N
vg0141975851	C -> T	LOC_Os01g72370.2	intron_variant ; MODIFIER	silent_mutation	Average:40.346; most accessible tissue: Minghui63 root, score: 68.826	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141975851	NA	1.22E-07	Spikelet_length	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141975851	NA	1.69E-07	mr1038	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	2.45E-07	mr1038	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	1.65E-10	mr1389	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	3.03E-09	mr1389	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	8.48E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	5.42E-14	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	1.61E-12	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	6.97E-06	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	1.68E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	3.36E-06	mr1283_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	4.31E-08	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	1.01E-10	mr1389_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	3.36E-10	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	3.62E-07	mr1480_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	5.93E-06	mr1616_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	2.69E-06	mr1616_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	4.32E-09	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	8.82E-06	NA	mr1669_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	4.12E-07	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	2.76E-07	mr1706_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	2.70E-07	mr1749_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	7.18E-08	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	1.61E-06	mr1974_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	NA	1.21E-06	mr1984_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141975851	3.90E-06	3.90E-06	mr1984_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251