\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141963923:

Variant ID: vg0141963923 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 41963923
Reference Allele: AAlternative Allele: G,AG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, A: 0.44, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCTCTTATAGCACGCAAAATGGGTCTTCTGTATAGGTACTCTATTGGAGGCTGAAATAGTACTATCGGAGACTTATTTTGGGTTTGGGTGCCCTTATG[A/G,AG]
GTCACTTGTTGGAGACAGTCGTTATCATTAATGGCGACCCAAAACCGGGGTACTGTATCGAAATTCAAAAAAACTTATAAGAGTTCGTTATCATTGATGG

Reverse complement sequence

CCATCAATGATAACGAACTCTTATAAGTTTTTTTGAATTTCGATACAGTACCCCGGTTTTGGGTCGCCATTAATGATAACGACTGTCTCCAACAAGTGAC[T/C,CT]
CATAAGGGCACCCAAACCCAAAATAAGTCTCCGATAGTACTATTTCAGCCTCCAATAGAGTACCTATACAGAAGACCCATTTTGCGTGCTATAAGAGGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.00% 20.70% 9.73% 29.62% AG: 5.95%
All Indica  2759 26.40% 29.60% 12.54% 21.60% AG: 9.79%
All Japonica  1512 45.60% 1.70% 1.12% 51.26% AG: 0.33%
Aus  269 29.00% 37.90% 32.34% 0.37% AG: 0.37%
Indica I  595 42.50% 25.50% 1.01% 17.98% AG: 12.94%
Indica II  465 12.30% 12.00% 35.27% 37.85% AG: 2.58%
Indica III  913 18.60% 45.70% 8.87% 13.91% AG: 12.92%
Indica Intermediate  786 31.70% 24.60% 12.09% 23.66% AG: 8.02%
Temperate Japonica  767 78.20% 0.50% 0.91% 20.34% NA
Tropical Japonica  504 5.60% 3.60% 1.59% 88.49% AG: 0.79%
Japonica Intermediate  241 25.30% 1.70% 0.83% 71.78% AG: 0.41%
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 37.80% 14.40% 11.11% 31.11% AG: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141963923 A -> G LOC_Os01g72350.1 upstream_gene_variant ; 203.0bp to feature; MODIFIER silent_mutation Average:93.167; most accessible tissue: Minghui63 young leaf, score: 98.422 N N N N
vg0141963923 A -> G LOC_Os01g72350.2 upstream_gene_variant ; 203.0bp to feature; MODIFIER silent_mutation Average:93.167; most accessible tissue: Minghui63 young leaf, score: 98.422 N N N N
vg0141963923 A -> G LOC_Os01g72340.1 downstream_gene_variant ; 1136.0bp to feature; MODIFIER silent_mutation Average:93.167; most accessible tissue: Minghui63 young leaf, score: 98.422 N N N N
vg0141963923 A -> G LOC_Os01g72340-LOC_Os01g72350 intergenic_region ; MODIFIER silent_mutation Average:93.167; most accessible tissue: Minghui63 young leaf, score: 98.422 N N N N
vg0141963923 A -> DEL N N silent_mutation Average:93.167; most accessible tissue: Minghui63 young leaf, score: 98.422 N N N N
vg0141963923 A -> AG LOC_Os01g72350.1 upstream_gene_variant ; 202.0bp to feature; MODIFIER silent_mutation Average:93.167; most accessible tissue: Minghui63 young leaf, score: 98.422 N N N N
vg0141963923 A -> AG LOC_Os01g72350.2 upstream_gene_variant ; 202.0bp to feature; MODIFIER silent_mutation Average:93.167; most accessible tissue: Minghui63 young leaf, score: 98.422 N N N N
vg0141963923 A -> AG LOC_Os01g72340.1 downstream_gene_variant ; 1137.0bp to feature; MODIFIER silent_mutation Average:93.167; most accessible tissue: Minghui63 young leaf, score: 98.422 N N N N
vg0141963923 A -> AG LOC_Os01g72340-LOC_Os01g72350 intergenic_region ; MODIFIER silent_mutation Average:93.167; most accessible tissue: Minghui63 young leaf, score: 98.422 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0141963923 A AG 0.21 0.1 0.08 0.15 0.15 0.22
vg0141963923 A G 0.06 0.07 0.04 0.02 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141963923 NA 2.51E-06 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 6.66E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 2.02E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 5.21E-07 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 3.40E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 2.39E-08 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 7.67E-11 mr1543 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 1.25E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 3.40E-07 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 1.36E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 1.08E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 7.20E-07 mr1892 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 4.23E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 6.83E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 1.26E-09 mr1486_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 2.03E-08 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 5.10E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 4.99E-09 mr1543_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 2.70E-08 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141963923 NA 4.15E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251