\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141859911:

Variant ID: vg0141859911 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41859911
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TTAACTGTAGCATCACATTGTCAAAATCATGGCATAATTAGACTCAAAAGATTCGTCTCACGAATTAGTCCAAGCTTATGGAATGAGTTTTGTAATTAGT[A/G]
TATGTTTAATACTCTAAATTAATATCTAAATGTGATAGGTACTTAGAATAAGTCCCTGTAAACCAAACAGCCCCTGCTCCTCTCGTGGCCGTTTTGCTGT

Reverse complement sequence

ACAGCAAAACGGCCACGAGAGGAGCAGGGGCTGTTTGGTTTACAGGGACTTATTCTAAGTACCTATCACATTTAGATATTAATTTAGAGTATTAAACATA[T/C]
ACTAATTACAAAACTCATTCCATAAGCTTGGACTAATTCGTGAGACGAATCTTTTGAGTCTAATTATGCCATGATTTTGACAATGTGATGCTACAGTTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.10% 31.30% 6.41% 15.17% NA
All Indica  2759 19.10% 45.40% 10.15% 25.37% NA
All Japonica  1512 97.20% 1.40% 0.86% 0.60% NA
Aus  269 53.50% 45.70% 0.74% 0.00% NA
Indica I  595 21.00% 58.80% 10.92% 9.24% NA
Indica II  465 9.00% 18.90% 11.83% 60.22% NA
Indica III  913 19.30% 51.60% 8.43% 20.70% NA
Indica Intermediate  786 23.40% 43.60% 10.56% 22.39% NA
Temperate Japonica  767 99.20% 0.50% 0.00% 0.26% NA
Tropical Japonica  504 94.40% 2.00% 2.58% 0.99% NA
Japonica Intermediate  241 96.30% 2.90% 0.00% 0.83% NA
VI/Aromatic  96 32.30% 65.60% 1.04% 1.04% NA
Intermediate  90 63.30% 21.10% 7.78% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141859911 A -> G LOC_Os01g72190.1 upstream_gene_variant ; 1651.0bp to feature; MODIFIER silent_mutation Average:80.959; most accessible tissue: Minghui63 root, score: 95.527 N N N N
vg0141859911 A -> G LOC_Os01g72200.1 downstream_gene_variant ; 4708.0bp to feature; MODIFIER silent_mutation Average:80.959; most accessible tissue: Minghui63 root, score: 95.527 N N N N
vg0141859911 A -> G LOC_Os01g72170-LOC_Os01g72190 intergenic_region ; MODIFIER silent_mutation Average:80.959; most accessible tissue: Minghui63 root, score: 95.527 N N N N
vg0141859911 A -> DEL N N silent_mutation Average:80.959; most accessible tissue: Minghui63 root, score: 95.527 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0141859911 A G -0.02 -0.05 -0.04 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141859911 NA 5.78E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 9.94E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 2.47E-06 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 1.17E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 9.11E-07 mr1220 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 3.16E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 9.80E-06 mr1286 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 1.36E-07 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 5.72E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 1.48E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 5.84E-06 mr1450 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 1.62E-06 mr1461 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 8.72E-07 mr1511 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 8.43E-06 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 8.03E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 1.75E-09 mr1607 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 1.32E-06 mr1629 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 2.30E-06 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 3.63E-06 mr1677 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 4.89E-10 mr1680 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 7.68E-07 mr1680 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 2.84E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 4.31E-06 NA mr1972 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 2.72E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 1.65E-09 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 7.89E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141859911 NA 3.33E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251