\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141844729:

Variant ID: vg0141844729 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41844729
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTAATTAGGCTCAAAAGATTCGTCTCACGGTTTTCAGGCAAGTTATGAAATTAGTTTTTTCATTCGTGTCCAAAAACTCCTTCCGACATCCGGTCAAAC[G/A]
TCCGATTTGACACCCAAAAATTTTCATTTCACAAACTAAACAAACCCTGAACAGTACAAATTCATGAACATGTACAGTGCTCGAGGTCATCGTGGCTGGC

Reverse complement sequence

GCCAGCCACGATGACCTCGAGCACTGTACATGTTCATGAATTTGTACTGTTCAGGGTTTGTTTAGTTTGTGAAATGAAAATTTTTGGGTGTCAAATCGGA[C/T]
GTTTGACCGGATGTCGGAAGGAGTTTTTGGACACGAATGAAAAAACTAATTTCATAACTTGCCTGAAAACCGTGAGACGAATCTTTTGAGCCTAATTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 5.20% 0.04% 0.00% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 98.00% 1.90% 0.07% 0.00% NA
Aus  269 56.50% 43.50% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 98.20% 1.60% 0.20% 0.00% NA
Japonica Intermediate  241 91.70% 8.30% 0.00% 0.00% NA
VI/Aromatic  96 31.20% 68.80% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141844729 G -> A LOC_Os01g72150.1 upstream_gene_variant ; 1684.0bp to feature; MODIFIER silent_mutation Average:63.787; most accessible tissue: Minghui63 root, score: 79.522 N N N N
vg0141844729 G -> A LOC_Os01g72160.1 upstream_gene_variant ; 2976.0bp to feature; MODIFIER silent_mutation Average:63.787; most accessible tissue: Minghui63 root, score: 79.522 N N N N
vg0141844729 G -> A LOC_Os01g72120.1 downstream_gene_variant ; 3289.0bp to feature; MODIFIER silent_mutation Average:63.787; most accessible tissue: Minghui63 root, score: 79.522 N N N N
vg0141844729 G -> A LOC_Os01g72130.1 downstream_gene_variant ; 2180.0bp to feature; MODIFIER silent_mutation Average:63.787; most accessible tissue: Minghui63 root, score: 79.522 N N N N
vg0141844729 G -> A LOC_Os01g72140.1 intron_variant ; MODIFIER silent_mutation Average:63.787; most accessible tissue: Minghui63 root, score: 79.522 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141844729 3.79E-06 NA mr1040 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141844729 NA 9.15E-07 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141844729 NA 9.39E-08 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141844729 NA 5.79E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251