Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141829519:

Variant ID: vg0141829519 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41829519
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TATATAATATCCGATGTGATATGCTAAAACTTTACACCCCTCCATCTAAACACCCCCTATGGATGTGTATTGTACATGCGTGTTGCTGTATACACGTATA[C/T]
GCGTCTTCTAAAGTAACGAGAGAAGAAGAATGATTGCCGTTGACATCGAATTTGTTAGTAATACTGCGTACGGGTAACGTGACTAGACAATTGACCTTAT

Reverse complement sequence

ATAAGGTCAATTGTCTAGTCACGTTACCCGTACGCAGTATTACTAACAAATTCGATGTCAACGGCAATCATTCTTCTTCTCTCGTTACTTTAGAAGACGC[G/A]
TATACGTGTATACAGCAACACGCATGTACAATACACATCCATAGGGGGTGTTTAGATGGAGGGGTGTAAAGTTTTAGCATATCACATCGGATATTATATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.40% 32.40% 0.28% 0.00% NA
All Indica  2759 53.10% 46.50% 0.43% 0.00% NA
All Japonica  1512 96.80% 3.20% 0.07% 0.00% NA
Aus  269 59.50% 40.50% 0.00% 0.00% NA
Indica I  595 71.80% 27.60% 0.67% 0.00% NA
Indica II  465 23.70% 76.30% 0.00% 0.00% NA
Indica III  913 54.40% 45.00% 0.55% 0.00% NA
Indica Intermediate  786 54.70% 44.90% 0.38% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 92.50% 7.30% 0.20% 0.00% NA
Japonica Intermediate  241 96.70% 3.30% 0.00% 0.00% NA
VI/Aromatic  96 35.40% 64.60% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141829519 C -> T LOC_Os01g72090.1 upstream_gene_variant ; 4432.0bp to feature; MODIFIER silent_mutation Average:98.587; most accessible tissue: Minghui63 flower, score: 99.746 N N N N
vg0141829519 C -> T LOC_Os01g72100.1 upstream_gene_variant ; 2363.0bp to feature; MODIFIER silent_mutation Average:98.587; most accessible tissue: Minghui63 flower, score: 99.746 N N N N
vg0141829519 C -> T LOC_Os01g72090.2 upstream_gene_variant ; 4432.0bp to feature; MODIFIER silent_mutation Average:98.587; most accessible tissue: Minghui63 flower, score: 99.746 N N N N
vg0141829519 C -> T LOC_Os01g72110.1 downstream_gene_variant ; 1515.0bp to feature; MODIFIER silent_mutation Average:98.587; most accessible tissue: Minghui63 flower, score: 99.746 N N N N
vg0141829519 C -> T LOC_Os01g72100-LOC_Os01g72110 intergenic_region ; MODIFIER silent_mutation Average:98.587; most accessible tissue: Minghui63 flower, score: 99.746 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0141829519 C T -0.12 -0.11 -0.09 -0.03 -0.05 -0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141829519 NA 2.94E-17 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141829519 NA 3.90E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 6.26E-06 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 5.78E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 2.20E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 3.58E-07 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 4.58E-10 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 2.49E-15 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 2.83E-11 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 7.37E-06 mr1477_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 1.52E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 2.86E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 5.71E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 4.85E-26 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 1.02E-15 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 5.15E-07 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 2.77E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 3.94E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 5.37E-06 mr1706_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 4.91E-10 mr1706_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 1.56E-11 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 8.49E-07 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 1.74E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 4.00E-06 mr1960_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 1.25E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141829519 NA 1.38E-07 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251