Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141821909:

Variant ID: vg0141821909 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41821909
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.71, C: 0.29, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCTGCCTTTTTAGTCCTTTTTTCCTACTGGCTTGGTGATATGAGGTTAAAAGTTAAACATTGTGCATGCAAGGGGAAAAAGGGATCCGAGGCGTGTTA[T/C]
TTTTTGTTCTTTTGTTTCAGGCAAGGCTCGGATGACAACTTCCTTGATGTTTCCTTGGCGTGCTAGCTGTGGTTTGATGATCTCCCAGAACTGGAGGCAC

Reverse complement sequence

GTGCCTCCAGTTCTGGGAGATCATCAAACCACAGCTAGCACGCCAAGGAAACATCAAGGAAGTTGTCATCCGAGCCTTGCCTGAAACAAAAGAACAAAAA[A/G]
TAACACGCCTCGGATCCCTTTTTCCCCTTGCATGCACAATGTTTAACTTTTAACCTCATATCACCAAGCCAGTAGGAAAAAAGGACTAAAAAGGCAGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 49.60% 0.28% 0.00% NA
All Indica  2759 48.60% 51.00% 0.40% 0.00% NA
All Japonica  1512 53.80% 46.20% 0.00% 0.00% NA
Aus  269 41.30% 58.40% 0.37% 0.00% NA
Indica I  595 62.70% 37.00% 0.34% 0.00% NA
Indica II  465 22.40% 77.40% 0.22% 0.00% NA
Indica III  913 53.30% 46.40% 0.22% 0.00% NA
Indica Intermediate  786 47.80% 51.40% 0.76% 0.00% NA
Temperate Japonica  767 24.00% 76.00% 0.00% 0.00% NA
Tropical Japonica  504 88.50% 11.50% 0.00% 0.00% NA
Japonica Intermediate  241 76.30% 23.70% 0.00% 0.00% NA
VI/Aromatic  96 67.70% 32.30% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141821909 T -> C LOC_Os01g72080.1 downstream_gene_variant ; 2420.0bp to feature; MODIFIER silent_mutation Average:96.866; most accessible tissue: Minghui63 flower, score: 99.235 N N N N
vg0141821909 T -> C LOC_Os01g72090.1 downstream_gene_variant ; 360.0bp to feature; MODIFIER silent_mutation Average:96.866; most accessible tissue: Minghui63 flower, score: 99.235 N N N N
vg0141821909 T -> C LOC_Os01g72100.1 downstream_gene_variant ; 3973.0bp to feature; MODIFIER silent_mutation Average:96.866; most accessible tissue: Minghui63 flower, score: 99.235 N N N N
vg0141821909 T -> C LOC_Os01g72090.2 downstream_gene_variant ; 360.0bp to feature; MODIFIER silent_mutation Average:96.866; most accessible tissue: Minghui63 flower, score: 99.235 N N N N
vg0141821909 T -> C LOC_Os01g72080-LOC_Os01g72090 intergenic_region ; MODIFIER silent_mutation Average:96.866; most accessible tissue: Minghui63 flower, score: 99.235 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0141821909 T C -0.04 -0.05 -0.04 -0.03 -0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141821909 NA 1.75E-06 mr1021 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 3.11E-06 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 1.42E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 2.26E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 9.06E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 1.16E-09 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 1.01E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 8.36E-06 mr1031_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 8.99E-06 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 6.43E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 3.16E-08 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 7.77E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 1.07E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 9.37E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 1.21E-11 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 8.66E-08 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 5.77E-07 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 1.47E-06 mr1440_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 7.11E-07 mr1477_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 3.56E-06 mr1544_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 4.65E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 1.48E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 9.71E-11 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 1.22E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 6.10E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 5.77E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 2.40E-09 mr1706_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 3.90E-07 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 1.31E-13 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 7.25E-11 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 3.60E-07 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 2.08E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 3.92E-09 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 2.29E-06 mr1894_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 2.47E-06 mr1902_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 6.41E-08 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 7.27E-07 mr1960_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 1.99E-08 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 NA 6.08E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141821909 4.35E-06 4.35E-06 mr1985_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251