Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141748081:

Variant ID: vg0141748081 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41748081
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.10, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

ACCACATTTTCTAGAATAAAATTTGGTACTCCCATTACCTAAAATACTTCTCTAGCTCTCTAGTAAAAAGATCGGCACTAACAGAACTAAACATGATTCT[C/T]
CAATGTCAAATAAACTTGACCTAAGAAAGTAGAAGGTACCAAACTTTACACTAAAAGAAGCTAATAATAGTGCCTCCCGATACCTCTAAAAAGTGTAAAA

Reverse complement sequence

TTTTACACTTTTTAGAGGTATCGGGAGGCACTATTATTAGCTTCTTTTAGTGTAAAGTTTGGTACCTTCTACTTTCTTAGGTCAAGTTTATTTGACATTG[G/A]
AGAATCATGTTTAGTTCTGTTAGTGCCGATCTTTTTACTAGAGAGCTAGAGAAGTATTTTAGGTAATGGGAGTACCAAATTTTATTCTAGAAAATGTGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.30%	14.70%	0.00%	0.00%	NA
All Indica	2759	98.60%	1.40%	0.00%	0.00%	NA
All Japonica	1512	57.70%	42.30%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.20%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.50%	0.50%	0.00%	0.00%	NA
Indica Intermediate	786	96.90%	3.10%	0.00%	0.00%	NA
Temperate Japonica	767	81.90%	18.10%	0.00%	0.00%	NA
Tropical Japonica	504	31.20%	68.80%	0.00%	0.00%	NA
Japonica Intermediate	241	36.10%	63.90%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141748081	C -> T	LOC_Os01g72020.1	upstream_gene_variant ; 3415.0bp to feature; MODIFIER	silent_mutation	Average:41.722; most accessible tissue: Minghui63 root, score: 83.258	N	N	N	N
vg0141748081	C -> T	LOC_Os01g72020.2	upstream_gene_variant ; 3415.0bp to feature; MODIFIER	silent_mutation	Average:41.722; most accessible tissue: Minghui63 root, score: 83.258	N	N	N	N
vg0141748081	C -> T	LOC_Os01g72020-LOC_Os01g72030	intergenic_region ; MODIFIER	silent_mutation	Average:41.722; most accessible tissue: Minghui63 root, score: 83.258	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141748081	NA	8.10E-06	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	1.52E-07	mr1156	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	2.68E-06	mr1263	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	2.39E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	7.04E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	8.77E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	2.68E-06	mr1451	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	1.71E-07	mr1604	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	3.43E-20	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	4.17E-14	mr1641	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	3.13E-07	mr1646	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	1.18E-11	mr1668	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	3.10E-07	mr1668	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	2.07E-11	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	6.47E-06	mr1729	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	1.95E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	4.53E-09	mr1779	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	3.63E-12	mr1871	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	4.65E-10	mr1354_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	5.43E-07	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	8.09E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	3.59E-06	mr1420_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	6.69E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	1.62E-08	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	6.66E-22	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141748081	NA	1.29E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251