\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141747523:

Variant ID: vg0141747523 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 41747523
Reference Allele: ATAlternative Allele: TT,A,ATT
Primary Allele: ATSecondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTATTCAAAAACTTTTGTGATATGTGTAAAACTATATGTATACATAAAAGTATATTTAACAATAAATCAAATGATAGAAAAAGAATTAATAATTACTTAA[AT/TT,A,ATT]
TTTTTTGAATAAGACGAACGGTTAAACATTTTTAAAAAAGTCAACGGCGTCAAACATTTTGGGATGAAGGTAGTATATATATATATAGAAGATTATTTAT

Reverse complement sequence

ATAAATAATCTTCTATATATATATATACTACCTTCATCCCAAAATGTTTGACGCCGTTGACTTTTTTAAAAATGTTTAACCGTTCGTCTTATTCAAAAAA[AT/AA,T,AAT]
TTAAGTAATTATTAATTCTTTTTCTATCATTTGATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTACACATATCACAAAAGTTTTTGAATAA

Allele Frequencies:

Populations Population SizeFrequency of AT(primary allele) Frequency of TT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.70% 22.20% 1.46% 14.41% A: 7.17%; ATT: 0.04%
All Indica  2759 58.80% 35.80% 1.78% 1.05% A: 2.46%; ATT: 0.07%
All Japonica  1512 53.40% 2.60% 1.12% 42.06% A: 0.79%
Aus  269 40.90% 0.00% 0.37% 0.00% A: 58.74%
Indica I  595 73.80% 19.80% 2.86% 1.18% A: 2.35%
Indica II  465 18.50% 79.80% 0.86% 0.65% A: 0.22%
Indica III  913 74.30% 22.90% 0.88% 0.33% A: 1.53%; ATT: 0.11%
Indica Intermediate  786 53.30% 37.00% 2.54% 2.04% A: 4.96%; ATT: 0.13%
Temperate Japonica  767 78.70% 0.40% 1.69% 19.17% NA
Tropical Japonica  504 24.20% 6.90% 0.20% 68.25% A: 0.40%
Japonica Intermediate  241 33.60% 0.80% 1.24% 60.17% A: 4.15%
VI/Aromatic  96 6.20% 1.00% 1.04% 0.00% A: 91.67%
Intermediate  90 46.70% 20.00% 1.11% 17.78% A: 14.44%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141747523 AT -> A LOC_Os01g72020.1 upstream_gene_variant ; 2858.0bp to feature; MODIFIER silent_mutation Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373 N N N N
vg0141747523 AT -> A LOC_Os01g72020.2 upstream_gene_variant ; 2858.0bp to feature; MODIFIER silent_mutation Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373 N N N N
vg0141747523 AT -> A LOC_Os01g72020-LOC_Os01g72030 intergenic_region ; MODIFIER silent_mutation Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373 N N N N
vg0141747523 AT -> TT LOC_Os01g72020.1 upstream_gene_variant ; 2857.0bp to feature; MODIFIER silent_mutation Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373 N N N N
vg0141747523 AT -> TT LOC_Os01g72020.2 upstream_gene_variant ; 2857.0bp to feature; MODIFIER silent_mutation Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373 N N N N
vg0141747523 AT -> TT LOC_Os01g72020-LOC_Os01g72030 intergenic_region ; MODIFIER silent_mutation Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373 N N N N
vg0141747523 AT -> ATT LOC_Os01g72020.1 upstream_gene_variant ; 2859.0bp to feature; MODIFIER silent_mutation Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373 N N N N
vg0141747523 AT -> ATT LOC_Os01g72020.2 upstream_gene_variant ; 2859.0bp to feature; MODIFIER silent_mutation Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373 N N N N
vg0141747523 AT -> ATT LOC_Os01g72020-LOC_Os01g72030 intergenic_region ; MODIFIER silent_mutation Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373 N N N N
vg0141747523 AT -> DEL N N silent_mutation Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141747523 NA 1.18E-25 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141747523 NA 4.65E-21 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141747523 NA 5.80E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.45E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 5.46E-07 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 7.99E-07 mr1212 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 5.60E-06 mr1325 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 9.59E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.37E-09 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 7.51E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 8.43E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.33E-08 mr1172_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 7.44E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.31E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 2.19E-08 mr1186_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 2.48E-07 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 5.50E-06 mr1245_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.31E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 2.35E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 5.56E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 6.80E-08 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 2.34E-15 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.71E-14 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 2.19E-12 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 4.09E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.34E-18 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.40E-09 mr1352_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.03E-06 mr1355_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 7.35E-08 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.20E-07 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 7.38E-06 mr1373_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 6.23E-09 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 9.24E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 6.78E-06 mr1474_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 7.23E-08 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 9.62E-07 mr1616_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 5.13E-26 mr1627_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 2.27E-15 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 7.64E-08 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.41E-06 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.11E-06 mr1706_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 1.01E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 3.23E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523 NA 2.07E-08 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251