Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141747523:

Variant ID: vg0141747523 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 41747523
Reference Allele: AT	Alternative Allele: TT,A,ATT
Primary Allele: AT	Secondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTATTCAAAAACTTTTGTGATATGTGTAAAACTATATGTATACATAAAAGTATATTTAACAATAAATCAAATGATAGAAAAAGAATTAATAATTACTTAA[AT/TT,A,ATT]
TTTTTTGAATAAGACGAACGGTTAAACATTTTTAAAAAAGTCAACGGCGTCAAACATTTTGGGATGAAGGTAGTATATATATATATAGAAGATTATTTAT

Reverse complement sequence

ATAAATAATCTTCTATATATATATATACTACCTTCATCCCAAAATGTTTGACGCCGTTGACTTTTTTAAAAATGTTTAACCGTTCGTCTTATTCAAAAAA[AT/AA,T,AAT]
TTAAGTAATTATTAATTCTTTTTCTATCATTTGATTTATTGTTAAATATACTTTTATGTATACATATAGTTTTACACATATCACAAAAGTTTTTGAATAA

Allele Frequencies:

Populations	Population Size	Frequency of AT(primary allele)	Frequency of TT(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.70%	22.20%	1.46%	14.41%	A: 7.17%; ATT: 0.04%
All Indica	2759	58.80%	35.80%	1.78%	1.05%	A: 2.46%; ATT: 0.07%
All Japonica	1512	53.40%	2.60%	1.12%	42.06%	A: 0.79%
Aus	269	40.90%	0.00%	0.37%	0.00%	A: 58.74%
Indica I	595	73.80%	19.80%	2.86%	1.18%	A: 2.35%
Indica II	465	18.50%	79.80%	0.86%	0.65%	A: 0.22%
Indica III	913	74.30%	22.90%	0.88%	0.33%	A: 1.53%; ATT: 0.11%
Indica Intermediate	786	53.30%	37.00%	2.54%	2.04%	A: 4.96%; ATT: 0.13%
Temperate Japonica	767	78.70%	0.40%	1.69%	19.17%	NA
Tropical Japonica	504	24.20%	6.90%	0.20%	68.25%	A: 0.40%
Japonica Intermediate	241	33.60%	0.80%	1.24%	60.17%	A: 4.15%
VI/Aromatic	96	6.20%	1.00%	1.04%	0.00%	A: 91.67%
Intermediate	90	46.70%	20.00%	1.11%	17.78%	A: 14.44%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141747523	AT -> A	LOC_Os01g72020.1	upstream_gene_variant ; 2858.0bp to feature; MODIFIER	silent_mutation	Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373	N	N	N	N
vg0141747523	AT -> A	LOC_Os01g72020.2	upstream_gene_variant ; 2858.0bp to feature; MODIFIER	silent_mutation	Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373	N	N	N	N
vg0141747523	AT -> A	LOC_Os01g72020-LOC_Os01g72030	intergenic_region ; MODIFIER	silent_mutation	Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373	N	N	N	N
vg0141747523	AT -> TT	LOC_Os01g72020.1	upstream_gene_variant ; 2857.0bp to feature; MODIFIER	silent_mutation	Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373	N	N	N	N
vg0141747523	AT -> TT	LOC_Os01g72020.2	upstream_gene_variant ; 2857.0bp to feature; MODIFIER	silent_mutation	Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373	N	N	N	N
vg0141747523	AT -> TT	LOC_Os01g72020-LOC_Os01g72030	intergenic_region ; MODIFIER	silent_mutation	Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373	N	N	N	N
vg0141747523	AT -> ATT	LOC_Os01g72020.1	upstream_gene_variant ; 2859.0bp to feature; MODIFIER	silent_mutation	Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373	N	N	N	N
vg0141747523	AT -> ATT	LOC_Os01g72020.2	upstream_gene_variant ; 2859.0bp to feature; MODIFIER	silent_mutation	Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373	N	N	N	N
vg0141747523	AT -> ATT	LOC_Os01g72020-LOC_Os01g72030	intergenic_region ; MODIFIER	silent_mutation	Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373	N	N	N	N
vg0141747523	AT -> DEL	N	N	silent_mutation	Average:41.635; most accessible tissue: Zhenshan97 root, score: 87.373	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141747523	NA	1.18E-25	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141747523	NA	4.65E-21	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141747523	NA	5.80E-06	mr1042	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.45E-06	mr1163	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	5.46E-07	mr1192	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	7.99E-07	mr1212	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	5.60E-06	mr1325	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	9.59E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.37E-09	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	7.51E-06	mr1912	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	8.43E-06	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.33E-08	mr1172_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	7.44E-16	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.31E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	2.19E-08	mr1186_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	2.48E-07	mr1186_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	5.50E-06	mr1245_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.31E-06	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	2.35E-06	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	5.56E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	6.80E-08	mr1296_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	2.34E-15	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.71E-14	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	2.19E-12	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	4.09E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.34E-18	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.40E-09	mr1352_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.03E-06	mr1355_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	7.35E-08	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.20E-07	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	7.38E-06	mr1373_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	6.23E-09	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	9.24E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	6.78E-06	mr1474_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	7.23E-08	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	9.62E-07	mr1616_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	5.13E-26	mr1627_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	2.27E-15	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	7.64E-08	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.41E-06	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.11E-06	mr1706_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	1.01E-07	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	3.23E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141747523	NA	2.07E-08	mr1977_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251