\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141727155:

Variant ID: vg0141727155 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41727155
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


AGAAAACGTATGAGTATGATAAGGTTGCTGCATGTGAAAAAAATGAAGGATTAGAAAACCGAATATTTTGTAGGTTTGGATATTCAGAACACAGGAATAG[A/G]
AAATGGAGGATTAGAACACATGATTCTATCCTATGATAGCCAACGATGAATAAAAAAAAAACAGAGGTTTCGGAATCCCGTGTTTCCATGCGATTTGTAG

Reverse complement sequence

CTACAAATCGCATGGAAACACGGGATTCCGAAACCTCTGTTTTTTTTTTATTCATCGTTGGCTATCATAGGATAGAATCATGTGTTCTAATCCTCCATTT[T/C]
CTATTCCTGTGTTCTGAATATCCAAACCTACAAAATATTCGGTTTTCTAATCCTTCATTTTTTTCACATGCAGCAACCTTATCATACTCATACGTTTTCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 29.40% 0.08% 0.00% NA
All Indica  2759 52.00% 47.80% 0.14% 0.00% NA
All Japonica  1512 97.60% 2.40% 0.00% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 84.70% 15.30% 0.00% 0.00% NA
Indica II  465 26.00% 73.50% 0.43% 0.00% NA
Indica III  913 36.60% 63.40% 0.00% 0.00% NA
Indica Intermediate  786 60.70% 39.10% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 93.50% 6.50% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141727155 A -> G LOC_Os01g72000.1 upstream_gene_variant ; 903.0bp to feature; MODIFIER silent_mutation Average:90.755; most accessible tissue: Minghui63 young leaf, score: 96.776 N N N N
vg0141727155 A -> G LOC_Os01g72009.1 downstream_gene_variant ; 1496.0bp to feature; MODIFIER silent_mutation Average:90.755; most accessible tissue: Minghui63 young leaf, score: 96.776 N N N N
vg0141727155 A -> G LOC_Os01g72000-LOC_Os01g72009 intergenic_region ; MODIFIER silent_mutation Average:90.755; most accessible tissue: Minghui63 young leaf, score: 96.776 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0141727155 A G -0.04 -0.01 -0.01 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141727155 NA 2.08E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 NA 6.33E-06 mr1651 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 NA 9.68E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 NA 1.58E-06 mr1749 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 NA 5.60E-07 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 NA 6.95E-10 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 5.19E-06 1.92E-11 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 2.34E-06 6.36E-13 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 NA 1.54E-10 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 NA 2.62E-12 mr1527_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 NA 8.64E-08 mr1527_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 NA 2.78E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 NA 5.32E-08 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141727155 NA 4.46E-07 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251