\
| Variant ID: vg0141599281 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 41599281 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 119. )
GGTGTTATAAATGTTGCTAATTTTTTCTATAAATTTGGACAAATCTAAATAATTTTGATTGAGAAAAAAAATCAAACGATTTATAATAGAATAAATTTTA[C/T]
AAAACTACATATACTTTGACTAAATTATCATAAAATTACAGATTTAAGGTGATGTATCGTATAACTACATATTTAACAATAAAATTATCACAATACTACA
TGTAGTATTGTGATAATTTTATTGTTAAATATGTAGTTATACGATACATCACCTTAAATCTGTAATTTTATGATAATTTAGTCAAAGTATATGTAGTTTT[G/A]
TAAAATTTATTCTATTATAAATCGTTTGATTTTTTTTCTCAATCAAAATTATTTAGATTTGTCCAAATTTATAGAAAAAATTAGCAACATTTATAACACC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.20% | 33.30% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 44.00% | 55.20% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 64.90% | 33.60% | 1.51% | 0.00% | NA |
| Indica II | 465 | 24.10% | 75.30% | 0.65% | 0.00% | NA |
| Indica III | 913 | 36.00% | 63.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 49.40% | 49.90% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 23.30% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0141599281 | C -> T | LOC_Os01g71810.1 | upstream_gene_variant ; 4296.0bp to feature; MODIFIER | silent_mutation | Average:29.48; most accessible tissue: Zhenshan97 root, score: 74.877 | N | N | N | N |
| vg0141599281 | C -> T | LOC_Os01g71820.1 | upstream_gene_variant ; 589.0bp to feature; MODIFIER | silent_mutation | Average:29.48; most accessible tissue: Zhenshan97 root, score: 74.877 | N | N | N | N |
| vg0141599281 | C -> T | LOC_Os01g71830.1 | upstream_gene_variant ; 4016.0bp to feature; MODIFIER | silent_mutation | Average:29.48; most accessible tissue: Zhenshan97 root, score: 74.877 | N | N | N | N |
| vg0141599281 | C -> T | LOC_Os01g71820-LOC_Os01g71830 | intergenic_region ; MODIFIER | silent_mutation | Average:29.48; most accessible tissue: Zhenshan97 root, score: 74.877 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0141599281 | NA | 5.40E-07 | mr1053 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | 9.37E-06 | 4.37E-11 | mr1090 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | NA | 8.08E-06 | mr1147 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | NA | 1.51E-06 | mr1211 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | NA | 7.08E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | NA | 8.29E-07 | mr1761 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | NA | 2.39E-08 | mr1974 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | 4.61E-06 | 6.24E-11 | mr1974 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | 2.11E-06 | 2.11E-06 | mr1985 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | NA | 2.59E-07 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | NA | 2.31E-09 | mr1322_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | NA | 2.96E-08 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | NA | 1.62E-07 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141599281 | NA | 6.35E-07 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |