\
| Variant ID: vg0141576432 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 41576432 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 232. )
TAGGCTTCAAAATGCCTATCAATAAAATGTTCTGATTAGAGTCTTTATGCAAGCTCGGATATTCAACTGATAAGTGAACTGAGTGCTGAACAAAAGGACT[G/A]
AAGCTATAGCTTACCTACGAAACATGGACTCATCCACGGACTGCGGAATTCGAGCAACAAATATTCTAGTAGCCTTTTTTGATCCCTGTGATTTCATTTC
GAAATGAAATCACAGGGATCAAAAAAGGCTACTAGAATATTTGTTGCTCGAATTCCGCAGTCCGTGGATGAGTCCATGTTTCGTAGGTAAGCTATAGCTT[C/T]
AGTCCTTTTGTTCAGCACTCAGTTCACTTATCAGTTGAATATCCGAGCTTGCATAAAGACTCTAATCAGAACATTTTATTGATAGGCATTTTGAAGCCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 5.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 54.60% | 45.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0141576432 | G -> A | LOC_Os01g71760.1 | upstream_gene_variant ; 3125.0bp to feature; MODIFIER | silent_mutation | Average:45.349; most accessible tissue: Callus, score: 77.051 | N | N | N | N |
| vg0141576432 | G -> A | LOC_Os01g71770.1 | intron_variant ; MODIFIER | silent_mutation | Average:45.349; most accessible tissue: Callus, score: 77.051 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0141576432 | 2.85E-07 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141576432 | NA | 3.01E-10 | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141576432 | 7.52E-06 | NA | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141576432 | 3.26E-08 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141576432 | 1.67E-06 | 7.51E-14 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141576432 | 2.57E-07 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141576432 | 2.72E-07 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141576432 | 8.04E-09 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141576432 | 5.61E-08 | 3.87E-14 | mr1496_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |