\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141576432:

Variant ID: vg0141576432 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41576432
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGCTTCAAAATGCCTATCAATAAAATGTTCTGATTAGAGTCTTTATGCAAGCTCGGATATTCAACTGATAAGTGAACTGAGTGCTGAACAAAAGGACT[G/A]
AAGCTATAGCTTACCTACGAAACATGGACTCATCCACGGACTGCGGAATTCGAGCAACAAATATTCTAGTAGCCTTTTTTGATCCCTGTGATTTCATTTC

Reverse complement sequence

GAAATGAAATCACAGGGATCAAAAAAGGCTACTAGAATATTTGTTGCTCGAATTCCGCAGTCCGTGGATGAGTCCATGTTTCGTAGGTAAGCTATAGCTT[C/T]
AGTCCTTTTGTTCAGCACTCAGTTCACTTATCAGTTGAATATCCGAGCTTGCATAAAGACTCTAATCAGAACATTTTATTGATAGGCATTTTGAAGCCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 5.60% 0.02% 0.00% NA
All Indica  2759 98.40% 1.60% 0.00% 0.00% NA
All Japonica  1512 99.10% 0.90% 0.00% 0.00% NA
Aus  269 54.60% 45.00% 0.37% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.80% 2.20% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 2.30% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 24.00% 76.00% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141576432 G -> A LOC_Os01g71760.1 upstream_gene_variant ; 3125.0bp to feature; MODIFIER silent_mutation Average:45.349; most accessible tissue: Callus, score: 77.051 N N N N
vg0141576432 G -> A LOC_Os01g71770.1 intron_variant ; MODIFIER silent_mutation Average:45.349; most accessible tissue: Callus, score: 77.051 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141576432 2.85E-07 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432 NA 3.01E-10 mr1180 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432 7.52E-06 NA mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432 3.26E-08 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432 1.67E-06 7.51E-14 mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432 2.57E-07 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432 2.72E-07 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432 8.04E-09 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141576432 5.61E-08 3.87E-14 mr1496_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251