Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141570959:

Variant ID: vg0141570959 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41570959
Reference Allele: T	Alternative Allele: C,A
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCGTGTAGTTGAACGTCTCCTTGGCCACCGGGTACGCCACCGGCAGCGAGAAGAGCACCGTGACGGTGGCCACCCACACCACACCCACCCAGCCGACGA[T/C,A]
GACCCCGTACTTGCCGAGGTGGAACGGCCCGCGCACGAACGATCTCCGCGCCGTCGTCACGCGGAAAAACACCGGCAGCGCGCACGCGATCAACAAACCC

Reverse complement sequence

GGGTTTGTTGATCGCGTGCGCGCTGCCGGTGTTTTTCCGCGTGACGACGGCGCGGAGATCGTTCGTGCGCGGGCCGTTCCACCTCGGCAAGTACGGGGTC[A/G,T]
TCGTCGGCTGGGTGGGTGTGGTGTGGGTGGCCACCGTCACGGTGCTCTTCTCGCTGCCGGTGGCGTACCCGGTGGCCAAGGAGACGTTCAACTACACGCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.50%	10.00%	1.04%	39.46%	A: 0.02%
All Indica	2759	20.70%	11.90%	1.56%	65.86%	A: 0.04%
All Japonica	1512	98.10%	0.30%	0.07%	1.52%	NA
Aus	269	48.00%	50.60%	0.37%	1.12%	NA
Indica I	595	28.40%	24.90%	0.50%	46.22%	NA
Indica II	465	14.20%	1.30%	1.08%	83.44%	NA
Indica III	913	9.30%	10.30%	2.19%	78.20%	NA
Indica Intermediate	786	31.80%	10.20%	1.91%	55.98%	A: 0.13%
Temperate Japonica	767	99.20%	0.40%	0.13%	0.26%	NA
Tropical Japonica	504	96.80%	0.20%	0.00%	2.98%	NA
Japonica Intermediate	241	97.50%	0.00%	0.00%	2.49%	NA
VI/Aromatic	96	96.90%	1.00%	0.00%	2.08%	NA
Intermediate	90	71.10%	2.20%	4.44%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141570959	T -> A	LOC_Os01g71760.1	missense_variant ; p.Ile440Phe; MODERATE	nonsynonymous_codon ; I440F	Average:11.891; most accessible tissue: Callus, score: 63.886	benign	0.247	TOLERATED	0.15
vg0141570959	T -> DEL	LOC_Os01g71760.1	N	frameshift_variant	Average:11.891; most accessible tissue: Callus, score: 63.886	N	N	N	N
vg0141570959	T -> C	LOC_Os01g71760.1	missense_variant ; p.Ile440Val; MODERATE	nonsynonymous_codon ; I440V	Average:11.891; most accessible tissue: Callus, score: 63.886	benign	-0.474	TOLERATED	0.98

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141570959	NA	1.33E-08	mr1611	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	3.79E-06	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	5.94E-07	mr1920	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	6.67E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	8.79E-07	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	5.20E-06	mr1323_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	2.48E-09	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	4.65E-10	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	2.30E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	5.44E-09	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	6.80E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	3.59E-07	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	2.32E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959	NA	1.41E-06	mr1836_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251