\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141570959:

Variant ID: vg0141570959 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41570959
Reference Allele: TAlternative Allele: C,A
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCGTGTAGTTGAACGTCTCCTTGGCCACCGGGTACGCCACCGGCAGCGAGAAGAGCACCGTGACGGTGGCCACCCACACCACACCCACCCAGCCGACGA[T/C,A]
GACCCCGTACTTGCCGAGGTGGAACGGCCCGCGCACGAACGATCTCCGCGCCGTCGTCACGCGGAAAAACACCGGCAGCGCGCACGCGATCAACAAACCC

Reverse complement sequence

GGGTTTGTTGATCGCGTGCGCGCTGCCGGTGTTTTTCCGCGTGACGACGGCGCGGAGATCGTTCGTGCGCGGGCCGTTCCACCTCGGCAAGTACGGGGTC[A/G,T]
TCGTCGGCTGGGTGGGTGTGGTGTGGGTGGCCACCGTCACGGTGCTCTTCTCGCTGCCGGTGGCGTACCCGGTGGCCAAGGAGACGTTCAACTACACGCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.50% 10.00% 1.04% 39.46% A: 0.02%
All Indica  2759 20.70% 11.90% 1.56% 65.86% A: 0.04%
All Japonica  1512 98.10% 0.30% 0.07% 1.52% NA
Aus  269 48.00% 50.60% 0.37% 1.12% NA
Indica I  595 28.40% 24.90% 0.50% 46.22% NA
Indica II  465 14.20% 1.30% 1.08% 83.44% NA
Indica III  913 9.30% 10.30% 2.19% 78.20% NA
Indica Intermediate  786 31.80% 10.20% 1.91% 55.98% A: 0.13%
Temperate Japonica  767 99.20% 0.40% 0.13% 0.26% NA
Tropical Japonica  504 96.80% 0.20% 0.00% 2.98% NA
Japonica Intermediate  241 97.50% 0.00% 0.00% 2.49% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 71.10% 2.20% 4.44% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141570959 T -> A LOC_Os01g71760.1 missense_variant ; p.Ile440Phe; MODERATE nonsynonymous_codon ; I440F Average:11.891; most accessible tissue: Callus, score: 63.886 benign 0.247 TOLERATED 0.15
vg0141570959 T -> DEL LOC_Os01g71760.1 N frameshift_variant Average:11.891; most accessible tissue: Callus, score: 63.886 N N N N
vg0141570959 T -> C LOC_Os01g71760.1 missense_variant ; p.Ile440Val; MODERATE nonsynonymous_codon ; I440V Average:11.891; most accessible tissue: Callus, score: 63.886 benign -0.474 TOLERATED 0.98

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141570959 NA 1.33E-08 mr1611 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 3.79E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 5.94E-07 mr1920 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 6.67E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 8.79E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 5.20E-06 mr1323_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 2.48E-09 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 4.65E-10 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 2.30E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 5.44E-09 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 6.80E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 3.59E-07 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 2.32E-06 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141570959 NA 1.41E-06 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251