\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141568520:

Variant ID: vg0141568520 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41568520
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


TTGTACCTCCTATCTAACAAATTGATATTAACCAAGTCCCGCAGCAACGTGTGGGGCATCCTCAAGTTAATTAAGAGACAATATACATAACAGACACTAC[C/T]
TAATTTAAACACTACTACCTTATAGATTATGGAAACCGATATATATGTCGATCAGCTGGGAACAATAATAATCCATGGCCTTGTTTGGATCCTCCGGGCT

Reverse complement sequence

AGCCCGGAGGATCCAAACAAGGCCATGGATTATTATTGTTCCCAGCTGATCGACATATATATCGGTTTCCATAATCTATAAGGTAGTAGTGTTTAAATTA[G/A]
GTAGTGTCTGTTATGTATATTGTCTCTTAATTAACTTGAGGATGCCCCACACGTTGCTGCGGGACTTGGTTAATATCAATTTGTTAGATAGGAGGTACAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.70% 14.00% 0.99% 35.29% NA
All Indica  2759 28.60% 10.90% 1.67% 58.79% NA
All Japonica  1512 97.70% 0.90% 0.07% 1.32% NA
Aus  269 4.50% 94.10% 0.00% 1.49% NA
Indica I  595 53.30% 15.00% 1.68% 30.08% NA
Indica II  465 14.20% 2.20% 2.15% 81.51% NA
Indica III  913 14.10% 13.00% 0.88% 71.96% NA
Indica Intermediate  786 35.20% 10.70% 2.29% 51.78% NA
Temperate Japonica  767 99.60% 0.00% 0.13% 0.26% NA
Tropical Japonica  504 96.80% 0.20% 0.00% 2.98% NA
Japonica Intermediate  241 93.40% 5.40% 0.00% 1.24% NA
VI/Aromatic  96 18.80% 79.20% 0.00% 2.08% NA
Intermediate  90 58.90% 18.90% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141568520 C -> T LOC_Os01g71740.1 upstream_gene_variant ; 1891.0bp to feature; MODIFIER silent_mutation Average:14.777; most accessible tissue: Callus, score: 71.492 N N N N
vg0141568520 C -> T LOC_Os01g71750.1 upstream_gene_variant ; 943.0bp to feature; MODIFIER silent_mutation Average:14.777; most accessible tissue: Callus, score: 71.492 N N N N
vg0141568520 C -> T LOC_Os01g71760.1 downstream_gene_variant ; 2230.0bp to feature; MODIFIER silent_mutation Average:14.777; most accessible tissue: Callus, score: 71.492 N N N N
vg0141568520 C -> T LOC_Os01g71750-LOC_Os01g71760 intergenic_region ; MODIFIER silent_mutation Average:14.777; most accessible tissue: Callus, score: 71.492 N N N N
vg0141568520 C -> DEL N N silent_mutation Average:14.777; most accessible tissue: Callus, score: 71.492 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141568520 NA 1.15E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520 NA 3.95E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520 NA 4.64E-22 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520 NA 2.19E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520 NA 5.23E-08 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520 NA 8.11E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520 NA 7.77E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520 NA 2.72E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520 5.72E-06 NA mr1825 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520 3.40E-06 5.48E-06 mr1825 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251