Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141568520:

Variant ID: vg0141568520 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41568520
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:

TTGTACCTCCTATCTAACAAATTGATATTAACCAAGTCCCGCAGCAACGTGTGGGGCATCCTCAAGTTAATTAAGAGACAATATACATAACAGACACTAC[C/T]
TAATTTAAACACTACTACCTTATAGATTATGGAAACCGATATATATGTCGATCAGCTGGGAACAATAATAATCCATGGCCTTGTTTGGATCCTCCGGGCT

Reverse complement sequence

AGCCCGGAGGATCCAAACAAGGCCATGGATTATTATTGTTCCCAGCTGATCGACATATATATCGGTTTCCATAATCTATAAGGTAGTAGTGTTTAAATTA[G/A]
GTAGTGTCTGTTATGTATATTGTCTCTTAATTAACTTGAGGATGCCCCACACGTTGCTGCGGGACTTGGTTAATATCAATTTGTTAGATAGGAGGTACAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.70%	14.00%	0.99%	35.29%	NA
All Indica	2759	28.60%	10.90%	1.67%	58.79%	NA
All Japonica	1512	97.70%	0.90%	0.07%	1.32%	NA
Aus	269	4.50%	94.10%	0.00%	1.49%	NA
Indica I	595	53.30%	15.00%	1.68%	30.08%	NA
Indica II	465	14.20%	2.20%	2.15%	81.51%	NA
Indica III	913	14.10%	13.00%	0.88%	71.96%	NA
Indica Intermediate	786	35.20%	10.70%	2.29%	51.78%	NA
Temperate Japonica	767	99.60%	0.00%	0.13%	0.26%	NA
Tropical Japonica	504	96.80%	0.20%	0.00%	2.98%	NA
Japonica Intermediate	241	93.40%	5.40%	0.00%	1.24%	NA
VI/Aromatic	96	18.80%	79.20%	0.00%	2.08%	NA
Intermediate	90	58.90%	18.90%	0.00%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141568520	C -> T	LOC_Os01g71740.1	upstream_gene_variant ; 1891.0bp to feature; MODIFIER	silent_mutation	Average:14.777; most accessible tissue: Callus, score: 71.492	N	N	N	N
vg0141568520	C -> T	LOC_Os01g71750.1	upstream_gene_variant ; 943.0bp to feature; MODIFIER	silent_mutation	Average:14.777; most accessible tissue: Callus, score: 71.492	N	N	N	N
vg0141568520	C -> T	LOC_Os01g71760.1	downstream_gene_variant ; 2230.0bp to feature; MODIFIER	silent_mutation	Average:14.777; most accessible tissue: Callus, score: 71.492	N	N	N	N
vg0141568520	C -> T	LOC_Os01g71750-LOC_Os01g71760	intergenic_region ; MODIFIER	silent_mutation	Average:14.777; most accessible tissue: Callus, score: 71.492	N	N	N	N
vg0141568520	C -> DEL	N	N	silent_mutation	Average:14.777; most accessible tissue: Callus, score: 71.492	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141568520	NA	1.15E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520	NA	3.95E-07	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520	NA	4.64E-22	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520	NA	2.19E-08	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520	NA	5.23E-08	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520	NA	8.11E-12	mr1522	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520	NA	7.77E-07	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520	NA	2.72E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520	5.72E-06	NA	mr1825	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568520	3.40E-06	5.48E-06	mr1825	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251