\
| Variant ID: vg0141568520 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 41568520 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.14, others allele: 0.00, population size: 63. )
TTGTACCTCCTATCTAACAAATTGATATTAACCAAGTCCCGCAGCAACGTGTGGGGCATCCTCAAGTTAATTAAGAGACAATATACATAACAGACACTAC[C/T]
TAATTTAAACACTACTACCTTATAGATTATGGAAACCGATATATATGTCGATCAGCTGGGAACAATAATAATCCATGGCCTTGTTTGGATCCTCCGGGCT
AGCCCGGAGGATCCAAACAAGGCCATGGATTATTATTGTTCCCAGCTGATCGACATATATATCGGTTTCCATAATCTATAAGGTAGTAGTGTTTAAATTA[G/A]
GTAGTGTCTGTTATGTATATTGTCTCTTAATTAACTTGAGGATGCCCCACACGTTGCTGCGGGACTTGGTTAATATCAATTTGTTAGATAGGAGGTACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 49.70% | 14.00% | 0.99% | 35.29% | NA |
| All Indica | 2759 | 28.60% | 10.90% | 1.67% | 58.79% | NA |
| All Japonica | 1512 | 97.70% | 0.90% | 0.07% | 1.32% | NA |
| Aus | 269 | 4.50% | 94.10% | 0.00% | 1.49% | NA |
| Indica I | 595 | 53.30% | 15.00% | 1.68% | 30.08% | NA |
| Indica II | 465 | 14.20% | 2.20% | 2.15% | 81.51% | NA |
| Indica III | 913 | 14.10% | 13.00% | 0.88% | 71.96% | NA |
| Indica Intermediate | 786 | 35.20% | 10.70% | 2.29% | 51.78% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 96.80% | 0.20% | 0.00% | 2.98% | NA |
| Japonica Intermediate | 241 | 93.40% | 5.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 18.80% | 79.20% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 58.90% | 18.90% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0141568520 | C -> T | LOC_Os01g71740.1 | upstream_gene_variant ; 1891.0bp to feature; MODIFIER | silent_mutation | Average:14.777; most accessible tissue: Callus, score: 71.492 | N | N | N | N |
| vg0141568520 | C -> T | LOC_Os01g71750.1 | upstream_gene_variant ; 943.0bp to feature; MODIFIER | silent_mutation | Average:14.777; most accessible tissue: Callus, score: 71.492 | N | N | N | N |
| vg0141568520 | C -> T | LOC_Os01g71760.1 | downstream_gene_variant ; 2230.0bp to feature; MODIFIER | silent_mutation | Average:14.777; most accessible tissue: Callus, score: 71.492 | N | N | N | N |
| vg0141568520 | C -> T | LOC_Os01g71750-LOC_Os01g71760 | intergenic_region ; MODIFIER | silent_mutation | Average:14.777; most accessible tissue: Callus, score: 71.492 | N | N | N | N |
| vg0141568520 | C -> DEL | N | N | silent_mutation | Average:14.777; most accessible tissue: Callus, score: 71.492 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0141568520 | NA | 1.15E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568520 | NA | 3.95E-07 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568520 | NA | 4.64E-22 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568520 | NA | 2.19E-08 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568520 | NA | 5.23E-08 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568520 | NA | 8.11E-12 | mr1522 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568520 | NA | 7.77E-07 | mr1652 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568520 | NA | 2.72E-10 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568520 | 5.72E-06 | NA | mr1825 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568520 | 3.40E-06 | 5.48E-06 | mr1825 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |