\
| Variant ID: vg0141568411 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 41568411 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, A: 0.14, others allele: 0.00, population size: 65. )
TGTAGCTTATGCTTTGAATGCGCTACTTAAATTATCTACAAATTTTGGACAGGGTTGCTAAAAAGAATTTCTCTAAGAAAGTCATTTGTTTCTTCCTTTC[T/A]
TCTTGAGATTGTACCTCCTATCTAACAAATTGATATTAACCAAGTCCCGCAGCAACGTGTGGGGCATCCTCAAGTTAATTAAGAGACAATATACATAACA
TGTTATGTATATTGTCTCTTAATTAACTTGAGGATGCCCCACACGTTGCTGCGGGACTTGGTTAATATCAATTTGTTAGATAGGAGGTACAATCTCAAGA[A/T]
GAAAGGAAGAAACAAATGACTTTCTTAGAGAAATTCTTTTTAGCAACCCTGTCCAAAATTTGTAGATAATTTAAGTAGCGCATTCAAAGCATAAGCTACA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 14.00% | 1.33% | 34.53% | NA |
| All Indica | 2759 | 29.30% | 11.00% | 2.25% | 57.48% | NA |
| All Japonica | 1512 | 97.70% | 0.90% | 0.07% | 1.32% | NA |
| Aus | 269 | 4.80% | 93.70% | 0.00% | 1.49% | NA |
| Indica I | 595 | 53.80% | 15.10% | 2.18% | 28.91% | NA |
| Indica II | 465 | 16.10% | 2.40% | 1.51% | 80.00% | NA |
| Indica III | 913 | 14.20% | 12.80% | 2.08% | 70.87% | NA |
| Indica Intermediate | 786 | 36.00% | 10.80% | 2.93% | 50.25% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 96.80% | 0.20% | 0.00% | 2.98% | NA |
| Japonica Intermediate | 241 | 93.40% | 5.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 18.80% | 79.20% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 60.00% | 17.80% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0141568411 | T -> A | LOC_Os01g71740.1 | upstream_gene_variant ; 1782.0bp to feature; MODIFIER | silent_mutation | Average:9.763; most accessible tissue: Callus, score: 45.953 | N | N | N | N |
| vg0141568411 | T -> A | LOC_Os01g71750.1 | upstream_gene_variant ; 834.0bp to feature; MODIFIER | silent_mutation | Average:9.763; most accessible tissue: Callus, score: 45.953 | N | N | N | N |
| vg0141568411 | T -> A | LOC_Os01g71760.1 | downstream_gene_variant ; 2339.0bp to feature; MODIFIER | silent_mutation | Average:9.763; most accessible tissue: Callus, score: 45.953 | N | N | N | N |
| vg0141568411 | T -> A | LOC_Os01g71750-LOC_Os01g71760 | intergenic_region ; MODIFIER | silent_mutation | Average:9.763; most accessible tissue: Callus, score: 45.953 | N | N | N | N |
| vg0141568411 | T -> DEL | N | N | silent_mutation | Average:9.763; most accessible tissue: Callus, score: 45.953 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0141568411 | NA | 4.33E-07 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568411 | NA | 6.02E-07 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568411 | 1.49E-06 | NA | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568411 | NA | 5.29E-08 | mr1369 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568411 | NA | 1.64E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568411 | NA | 3.44E-10 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141568411 | 8.92E-06 | 9.14E-06 | mr1825 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |