\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141568411:

Variant ID: vg0141568411 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41568411
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, A: 0.14, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAGCTTATGCTTTGAATGCGCTACTTAAATTATCTACAAATTTTGGACAGGGTTGCTAAAAAGAATTTCTCTAAGAAAGTCATTTGTTTCTTCCTTTC[T/A]
TCTTGAGATTGTACCTCCTATCTAACAAATTGATATTAACCAAGTCCCGCAGCAACGTGTGGGGCATCCTCAAGTTAATTAAGAGACAATATACATAACA

Reverse complement sequence

TGTTATGTATATTGTCTCTTAATTAACTTGAGGATGCCCCACACGTTGCTGCGGGACTTGGTTAATATCAATTTGTTAGATAGGAGGTACAATCTCAAGA[A/T]
GAAAGGAAGAAACAAATGACTTTCTTAGAGAAATTCTTTTTAGCAACCCTGTCCAAAATTTGTAGATAATTTAAGTAGCGCATTCAAAGCATAAGCTACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 14.00% 1.33% 34.53% NA
All Indica  2759 29.30% 11.00% 2.25% 57.48% NA
All Japonica  1512 97.70% 0.90% 0.07% 1.32% NA
Aus  269 4.80% 93.70% 0.00% 1.49% NA
Indica I  595 53.80% 15.10% 2.18% 28.91% NA
Indica II  465 16.10% 2.40% 1.51% 80.00% NA
Indica III  913 14.20% 12.80% 2.08% 70.87% NA
Indica Intermediate  786 36.00% 10.80% 2.93% 50.25% NA
Temperate Japonica  767 99.60% 0.00% 0.13% 0.26% NA
Tropical Japonica  504 96.80% 0.20% 0.00% 2.98% NA
Japonica Intermediate  241 93.40% 5.40% 0.00% 1.24% NA
VI/Aromatic  96 18.80% 79.20% 0.00% 2.08% NA
Intermediate  90 60.00% 17.80% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141568411 T -> A LOC_Os01g71740.1 upstream_gene_variant ; 1782.0bp to feature; MODIFIER silent_mutation Average:9.763; most accessible tissue: Callus, score: 45.953 N N N N
vg0141568411 T -> A LOC_Os01g71750.1 upstream_gene_variant ; 834.0bp to feature; MODIFIER silent_mutation Average:9.763; most accessible tissue: Callus, score: 45.953 N N N N
vg0141568411 T -> A LOC_Os01g71760.1 downstream_gene_variant ; 2339.0bp to feature; MODIFIER silent_mutation Average:9.763; most accessible tissue: Callus, score: 45.953 N N N N
vg0141568411 T -> A LOC_Os01g71750-LOC_Os01g71760 intergenic_region ; MODIFIER silent_mutation Average:9.763; most accessible tissue: Callus, score: 45.953 N N N N
vg0141568411 T -> DEL N N silent_mutation Average:9.763; most accessible tissue: Callus, score: 45.953 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141568411 NA 4.33E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411 NA 6.02E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411 1.49E-06 NA mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411 NA 5.29E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411 NA 1.64E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411 NA 3.44E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411 8.92E-06 9.14E-06 mr1825 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251