Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141568411:

Variant ID: vg0141568411 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41568411
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.86, A: 0.14, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:

TGTAGCTTATGCTTTGAATGCGCTACTTAAATTATCTACAAATTTTGGACAGGGTTGCTAAAAAGAATTTCTCTAAGAAAGTCATTTGTTTCTTCCTTTC[T/A]
TCTTGAGATTGTACCTCCTATCTAACAAATTGATATTAACCAAGTCCCGCAGCAACGTGTGGGGCATCCTCAAGTTAATTAAGAGACAATATACATAACA

Reverse complement sequence

TGTTATGTATATTGTCTCTTAATTAACTTGAGGATGCCCCACACGTTGCTGCGGGACTTGGTTAATATCAATTTGTTAGATAGGAGGTACAATCTCAAGA[A/T]
GAAAGGAAGAAACAAATGACTTTCTTAGAGAAATTCTTTTTAGCAACCCTGTCCAAAATTTGTAGATAATTTAAGTAGCGCATTCAAAGCATAAGCTACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	14.00%	1.33%	34.53%	NA
All Indica	2759	29.30%	11.00%	2.25%	57.48%	NA
All Japonica	1512	97.70%	0.90%	0.07%	1.32%	NA
Aus	269	4.80%	93.70%	0.00%	1.49%	NA
Indica I	595	53.80%	15.10%	2.18%	28.91%	NA
Indica II	465	16.10%	2.40%	1.51%	80.00%	NA
Indica III	913	14.20%	12.80%	2.08%	70.87%	NA
Indica Intermediate	786	36.00%	10.80%	2.93%	50.25%	NA
Temperate Japonica	767	99.60%	0.00%	0.13%	0.26%	NA
Tropical Japonica	504	96.80%	0.20%	0.00%	2.98%	NA
Japonica Intermediate	241	93.40%	5.40%	0.00%	1.24%	NA
VI/Aromatic	96	18.80%	79.20%	0.00%	2.08%	NA
Intermediate	90	60.00%	17.80%	0.00%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141568411	T -> A	LOC_Os01g71740.1	upstream_gene_variant ; 1782.0bp to feature; MODIFIER	silent_mutation	Average:9.763; most accessible tissue: Callus, score: 45.953	N	N	N	N
vg0141568411	T -> A	LOC_Os01g71750.1	upstream_gene_variant ; 834.0bp to feature; MODIFIER	silent_mutation	Average:9.763; most accessible tissue: Callus, score: 45.953	N	N	N	N
vg0141568411	T -> A	LOC_Os01g71760.1	downstream_gene_variant ; 2339.0bp to feature; MODIFIER	silent_mutation	Average:9.763; most accessible tissue: Callus, score: 45.953	N	N	N	N
vg0141568411	T -> A	LOC_Os01g71750-LOC_Os01g71760	intergenic_region ; MODIFIER	silent_mutation	Average:9.763; most accessible tissue: Callus, score: 45.953	N	N	N	N
vg0141568411	T -> DEL	N	N	silent_mutation	Average:9.763; most accessible tissue: Callus, score: 45.953	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141568411	NA	4.33E-07	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411	NA	6.02E-07	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411	1.49E-06	NA	mr1083	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411	NA	5.29E-08	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411	NA	1.64E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411	NA	3.44E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141568411	8.92E-06	9.14E-06	mr1825	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251