\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141519930:

Variant ID: vg0141519930 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41519930
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAAAATCTATATAAACTTGAGCACCAAGCTTGTGATTGCCATATGACACACATACTGCATTGAGATCAGACGAGCACCGAATGAGGATCGCCGTTTTC[C/A]
CCGCCAAAAAAATGGGGTCGGAGTTTTGGCGGTATATTTTCTTTTTGTCCTTTTCATTTTTCCATCTCTCTTCGTTAATTTTTTTTCCCAATCTCTCGTT

Reverse complement sequence

AACGAGAGATTGGGAAAAAAAATTAACGAAGAGAGATGGAAAAATGAAAAGGACAAAAAGAAAATATACCGCCAAAACTCCGACCCCATTTTTTTGGCGG[G/T]
GAAAACGGCGATCCTCATTCGGTGCTCGTCTGATCTCAATGCAGTATGTGTGTCATATGGCAATCACAAGCTTGGTGCTCAAGTTTATATAGATTTTGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.40% 5.50% 2.79% 36.27% NA
All Indica  2759 29.80% 9.40% 4.24% 56.61% NA
All Japonica  1512 97.90% 0.10% 0.60% 1.32% NA
Aus  269 58.00% 0.00% 0.37% 41.64% NA
Indica I  595 62.20% 16.30% 3.53% 17.98% NA
Indica II  465 6.50% 8.20% 3.87% 81.51% NA
Indica III  913 25.10% 0.40% 2.52% 71.96% NA
Indica Intermediate  786 24.60% 15.10% 7.00% 53.31% NA
Temperate Japonica  767 99.10% 0.10% 0.52% 0.26% NA
Tropical Japonica  504 96.40% 0.20% 0.40% 2.98% NA
Japonica Intermediate  241 97.50% 0.00% 1.24% 1.24% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 74.40% 0.00% 5.56% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141519930 C -> A LOC_Os01g71640.1 upstream_gene_variant ; 4581.0bp to feature; MODIFIER silent_mutation Average:57.894; most accessible tissue: Callus, score: 98.814 N N N N
vg0141519930 C -> A LOC_Os01g71630.1 downstream_gene_variant ; 200.0bp to feature; MODIFIER silent_mutation Average:57.894; most accessible tissue: Callus, score: 98.814 N N N N
vg0141519930 C -> A LOC_Os01g71630.2 downstream_gene_variant ; 200.0bp to feature; MODIFIER silent_mutation Average:57.894; most accessible tissue: Callus, score: 98.814 N N N N
vg0141519930 C -> A LOC_Os01g71630.4 downstream_gene_variant ; 200.0bp to feature; MODIFIER silent_mutation Average:57.894; most accessible tissue: Callus, score: 98.814 N N N N
vg0141519930 C -> A LOC_Os01g71630-LOC_Os01g71640 intergenic_region ; MODIFIER silent_mutation Average:57.894; most accessible tissue: Callus, score: 98.814 N N N N
vg0141519930 C -> DEL N N silent_mutation Average:57.894; most accessible tissue: Callus, score: 98.814 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141519930 NA 5.80E-09 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141519930 NA 6.81E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141519930 NA 8.69E-06 mr1236 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141519930 NA 2.46E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141519930 NA 6.53E-08 mr1389 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141519930 NA 2.06E-07 mr1389 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141519930 NA 2.46E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141519930 NA 3.72E-10 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141519930 NA 1.33E-09 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141519930 NA 2.37E-07 mr1389_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141519930 NA 1.51E-07 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141519930 1.84E-06 6.04E-06 mr1974_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141519930 1.87E-06 4.22E-08 mr1974_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251