\
| Variant ID: vg0141519930 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 41519930 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 191. )
TGCAAAATCTATATAAACTTGAGCACCAAGCTTGTGATTGCCATATGACACACATACTGCATTGAGATCAGACGAGCACCGAATGAGGATCGCCGTTTTC[C/A]
CCGCCAAAAAAATGGGGTCGGAGTTTTGGCGGTATATTTTCTTTTTGTCCTTTTCATTTTTCCATCTCTCTTCGTTAATTTTTTTTCCCAATCTCTCGTT
AACGAGAGATTGGGAAAAAAAATTAACGAAGAGAGATGGAAAAATGAAAAGGACAAAAAGAAAATATACCGCCAAAACTCCGACCCCATTTTTTTGGCGG[G/T]
GAAAACGGCGATCCTCATTCGGTGCTCGTCTGATCTCAATGCAGTATGTGTGTCATATGGCAATCACAAGCTTGGTGCTCAAGTTTATATAGATTTTGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.40% | 5.50% | 2.79% | 36.27% | NA |
| All Indica | 2759 | 29.80% | 9.40% | 4.24% | 56.61% | NA |
| All Japonica | 1512 | 97.90% | 0.10% | 0.60% | 1.32% | NA |
| Aus | 269 | 58.00% | 0.00% | 0.37% | 41.64% | NA |
| Indica I | 595 | 62.20% | 16.30% | 3.53% | 17.98% | NA |
| Indica II | 465 | 6.50% | 8.20% | 3.87% | 81.51% | NA |
| Indica III | 913 | 25.10% | 0.40% | 2.52% | 71.96% | NA |
| Indica Intermediate | 786 | 24.60% | 15.10% | 7.00% | 53.31% | NA |
| Temperate Japonica | 767 | 99.10% | 0.10% | 0.52% | 0.26% | NA |
| Tropical Japonica | 504 | 96.40% | 0.20% | 0.40% | 2.98% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 1.24% | 1.24% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 74.40% | 0.00% | 5.56% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0141519930 | C -> A | LOC_Os01g71640.1 | upstream_gene_variant ; 4581.0bp to feature; MODIFIER | silent_mutation | Average:57.894; most accessible tissue: Callus, score: 98.814 | N | N | N | N |
| vg0141519930 | C -> A | LOC_Os01g71630.1 | downstream_gene_variant ; 200.0bp to feature; MODIFIER | silent_mutation | Average:57.894; most accessible tissue: Callus, score: 98.814 | N | N | N | N |
| vg0141519930 | C -> A | LOC_Os01g71630.2 | downstream_gene_variant ; 200.0bp to feature; MODIFIER | silent_mutation | Average:57.894; most accessible tissue: Callus, score: 98.814 | N | N | N | N |
| vg0141519930 | C -> A | LOC_Os01g71630.4 | downstream_gene_variant ; 200.0bp to feature; MODIFIER | silent_mutation | Average:57.894; most accessible tissue: Callus, score: 98.814 | N | N | N | N |
| vg0141519930 | C -> A | LOC_Os01g71630-LOC_Os01g71640 | intergenic_region ; MODIFIER | silent_mutation | Average:57.894; most accessible tissue: Callus, score: 98.814 | N | N | N | N |
| vg0141519930 | C -> DEL | N | N | silent_mutation | Average:57.894; most accessible tissue: Callus, score: 98.814 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0141519930 | NA | 5.80E-09 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0141519930 | NA | 6.81E-06 | mr1236 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141519930 | NA | 8.69E-06 | mr1236 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141519930 | NA | 2.46E-06 | mr1376 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141519930 | NA | 6.53E-08 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141519930 | NA | 2.06E-07 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141519930 | NA | 2.46E-06 | mr1431 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141519930 | NA | 3.72E-10 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141519930 | NA | 1.33E-09 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141519930 | NA | 2.37E-07 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141519930 | NA | 1.51E-07 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141519930 | 1.84E-06 | 6.04E-06 | mr1974_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141519930 | 1.87E-06 | 4.22E-08 | mr1974_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |