\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141387129:

Variant ID: vg0141387129 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 41387129
Reference Allele: AAlternative Allele: AGG,G
Primary Allele: ASecondary Allele: AGG

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.54, A: 0.46, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TGGACGGGATACCCTTCGTCCACCTTTCCCATCCAAATAGGAACGAGGCTGAGCACCTAAGCCGTGAGGAGGAGGTGGCCATCGGCGCCTAAGCCGTGAG[A/AGG,G]
AGGTGGCCATCGGCGACTCCGGCGCAGGCTGGGAATAAGACCCGCTCGGGGAGAAGAGGACGTGGCCACCGGAGACGCGGCCGCCGGCAACATGGTCGTT

Reverse complement sequence

AACGACCATGTTGCCGGCGGCCGCGTCTCCGGTGGCCACGTCCTCTTCTCCCCGAGCGGGTCTTATTCCCAGCCTGCGCCGGAGTCGCCGATGGCCACCT[T/CCT,C]
CTCACGGCTTAGGCGCCGATGGCCACCTCCTCCTCACGGCTTAGGTGCTCAGCCTCGTTCCTATTTGGATGGGAAAGGTGGACGAAGGGTATCCCGTCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AGG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 36.10% 1.90% 0.00% G: 10.79%
All Indica  2759 28.10% 60.10% 3.04% 0.00% G: 8.74%
All Japonica  1512 94.40% 1.50% 0.13% 0.00% G: 4.03%
Aus  269 29.70% 1.50% 0.00% 0.00% G: 68.77%
Indica I  595 56.10% 37.00% 0.84% 0.00% G: 6.05%
Indica II  465 13.30% 79.80% 5.16% 0.00% G: 1.72%
Indica III  913 12.20% 72.90% 2.63% 0.00% G: 12.27%
Indica Intermediate  786 34.10% 51.10% 3.94% 0.00% G: 10.81%
Temperate Japonica  767 98.60% 0.40% 0.00% 0.00% G: 1.04%
Tropical Japonica  504 93.10% 3.20% 0.40% 0.00% G: 3.37%
Japonica Intermediate  241 83.80% 1.20% 0.00% 0.00% G: 14.94%
VI/Aromatic  96 81.20% 0.00% 0.00% 0.00% G: 18.75%
Intermediate  90 64.40% 25.60% 4.44% 0.00% G: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141387129 A -> G LOC_Os01g71420.1 upstream_gene_variant ; 712.0bp to feature; MODIFIER silent_mutation Average:67.594; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0141387129 A -> G LOC_Os01g71430.1 downstream_gene_variant ; 1806.0bp to feature; MODIFIER silent_mutation Average:67.594; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0141387129 A -> G LOC_Os01g71440.1 downstream_gene_variant ; 3816.0bp to feature; MODIFIER silent_mutation Average:67.594; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0141387129 A -> G LOC_Os01g71420-LOC_Os01g71430 intergenic_region ; MODIFIER silent_mutation Average:67.594; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0141387129 A -> AGG LOC_Os01g71420.1 upstream_gene_variant ; 713.0bp to feature; MODIFIER silent_mutation Average:67.594; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0141387129 A -> AGG LOC_Os01g71430.1 downstream_gene_variant ; 1805.0bp to feature; MODIFIER silent_mutation Average:67.594; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0141387129 A -> AGG LOC_Os01g71440.1 downstream_gene_variant ; 3815.0bp to feature; MODIFIER silent_mutation Average:67.594; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N
vg0141387129 A -> AGG LOC_Os01g71420-LOC_Os01g71430 intergenic_region ; MODIFIER silent_mutation Average:67.594; most accessible tissue: Zhenshan97 panicle, score: 83.904 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0141387129 A AGG 0.06 0.06 0.07 0.08 0.08 0.05
vg0141387129 A G 0.03 0.05 0.03 0.03 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141387129 NA 7.00E-06 mr1070 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141387129 NA 1.01E-06 mr1180 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141387129 NA 3.48E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141387129 NA 8.43E-06 mr1970 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141387129 2.42E-06 2.42E-06 mr1067_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251