\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141380906:

Variant ID: vg0141380906 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41380906
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GGGCGGATGTGAGGTGGTTCCCGTTGCGTAGATTTGTTTGCCTGTGCTTTGTGAAAAGTTGTTGTGGTGTGGGAATCGTAACCAGAATCAGCCTATGTGG[T/C]
AGATGGATGACCTGAGTGGTCAGAAACGAATCTGTGTGATTCGGGATGTCTACGGGCATCATAGACTAGGCTTCCCGAGTGGAAGCGGATTGCTTTGCTG

Reverse complement sequence

CAGCAAAGCAATCCGCTTCCACTCGGGAAGCCTAGTCTATGATGCCCGTAGACATCCCGAATCACACAGATTCGTTTCTGACCACTCAGGTCATCCATCT[A/G]
CCACATAGGCTGATTCTGGTTACGATTCCCACACCACAACAACTTTTCACAAAGCACAGGCAAACAAATCTACGCAACGGGAACCACCTCACATCCGCCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 1.30% 31.17% 11.96% NA
All Indica  2759 30.40% 2.00% 48.28% 19.32% NA
All Japonica  1512 97.80% 0.10% 1.79% 0.33% NA
Aus  269 87.40% 1.10% 9.67% 1.86% NA
Indica I  595 59.00% 0.80% 32.27% 7.90% NA
Indica II  465 15.90% 0.00% 38.92% 45.16% NA
Indica III  913 12.90% 3.60% 69.77% 13.69% NA
Indica Intermediate  786 37.80% 2.00% 40.97% 19.21% NA
Temperate Japonica  767 99.30% 0.10% 0.26% 0.26% NA
Tropical Japonica  504 96.60% 0.00% 2.78% 0.60% NA
Japonica Intermediate  241 95.40% 0.00% 4.56% 0.00% NA
VI/Aromatic  96 14.60% 3.10% 73.96% 8.33% NA
Intermediate  90 63.30% 2.20% 18.89% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141380906 T -> DEL N N silent_mutation Average:16.683; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N
vg0141380906 T -> C LOC_Os01g71410.1 downstream_gene_variant ; 4609.0bp to feature; MODIFIER silent_mutation Average:16.683; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N
vg0141380906 T -> C LOC_Os01g71420.1 downstream_gene_variant ; 3380.0bp to feature; MODIFIER silent_mutation Average:16.683; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N
vg0141380906 T -> C LOC_Os01g71410-LOC_Os01g71420 intergenic_region ; MODIFIER silent_mutation Average:16.683; most accessible tissue: Minghui63 young leaf, score: 21.268 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141380906 3.81E-06 3.81E-06 mr1753 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141380906 NA 4.05E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141380906 9.38E-06 1.96E-08 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251