\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141321523:

Variant ID: vg0141321523 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41321523
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 65. )

Flanking Sequence (100 bp) in Reference Genome:


TAAGTCTACTATAAACTTATGTGGAGGAGAGAGGTAAACAAAATAAAAGAGTGTTGGCTCTCATACAAGAGCTAGCTTAACACAAGTTCCAAGACAAATA[T/C]
ATTAAATGTATAAGTAAGAGATAGAGATAGAAGAAGAAAATTATAGCTAATCTTATAGCTAATCTATTATATATGTTAACTTTAGTATAGGCTAATAGTA

Reverse complement sequence

TACTATTAGCCTATACTAAAGTTAACATATATAATAGATTAGCTATAAGATTAGCTATAATTTTCTTCTTCTATCTCTATCTCTTACTTATACATTTAAT[A/G]
TATTTGTCTTGGAACTTGTGTTAAGCTAGCTCTTGTATGAGAGCCAACACTCTTTTATTTTGTTTACCTCTCTCCTCCACATAAGTTTATAGTAGACTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.60% 42.90% 0.51% 0.00% NA
All Indica  2759 79.50% 20.40% 0.11% 0.00% NA
All Japonica  1512 6.20% 93.60% 0.26% 0.00% NA
Aus  269 95.90% 1.90% 2.23% 0.00% NA
Indica I  595 71.40% 28.40% 0.17% 0.00% NA
Indica II  465 88.60% 11.40% 0.00% 0.00% NA
Indica III  913 86.50% 13.40% 0.11% 0.00% NA
Indica Intermediate  786 72.10% 27.70% 0.13% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 7.30% 92.50% 0.20% 0.00% NA
Japonica Intermediate  241 18.30% 80.50% 1.24% 0.00% NA
VI/Aromatic  96 86.50% 3.10% 10.42% 0.00% NA
Intermediate  90 50.00% 48.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141321523 T -> C LOC_Os01g71320-LOC_Os01g71330 intergenic_region ; MODIFIER silent_mutation Average:45.987; most accessible tissue: Minghui63 root, score: 75.806 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141321523 NA 2.71E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141321523 NA 1.61E-06 mr1527 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141321523 NA 2.26E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141321523 NA 1.35E-13 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141321523 NA 5.98E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141321523 NA 1.30E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141321523 NA 1.26E-16 mr1553_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141321523 NA 1.77E-06 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141321523 NA 1.77E-08 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141321523 NA 4.71E-06 mr1974_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251