\
| Variant ID: vg0141321523 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 41321523 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 65. )
TAAGTCTACTATAAACTTATGTGGAGGAGAGAGGTAAACAAAATAAAAGAGTGTTGGCTCTCATACAAGAGCTAGCTTAACACAAGTTCCAAGACAAATA[T/C]
ATTAAATGTATAAGTAAGAGATAGAGATAGAAGAAGAAAATTATAGCTAATCTTATAGCTAATCTATTATATATGTTAACTTTAGTATAGGCTAATAGTA
TACTATTAGCCTATACTAAAGTTAACATATATAATAGATTAGCTATAAGATTAGCTATAATTTTCTTCTTCTATCTCTATCTCTTACTTATACATTTAAT[A/G]
TATTTGTCTTGGAACTTGTGTTAAGCTAGCTCTTGTATGAGAGCCAACACTCTTTTATTTTGTTTACCTCTCTCCTCCACATAAGTTTATAGTAGACTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.60% | 42.90% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 79.50% | 20.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 6.20% | 93.60% | 0.26% | 0.00% | NA |
| Aus | 269 | 95.90% | 1.90% | 2.23% | 0.00% | NA |
| Indica I | 595 | 71.40% | 28.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 88.60% | 11.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.50% | 13.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 72.10% | 27.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 1.60% | 98.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.30% | 92.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 18.30% | 80.50% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 3.10% | 10.42% | 0.00% | NA |
| Intermediate | 90 | 50.00% | 48.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0141321523 | T -> C | LOC_Os01g71320-LOC_Os01g71330 | intergenic_region ; MODIFIER | silent_mutation | Average:45.987; most accessible tissue: Minghui63 root, score: 75.806 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0141321523 | NA | 2.71E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141321523 | NA | 1.61E-06 | mr1527 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141321523 | NA | 2.26E-07 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141321523 | NA | 1.35E-13 | mr1553 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141321523 | NA | 5.98E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141321523 | NA | 1.30E-06 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141321523 | NA | 1.26E-16 | mr1553_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141321523 | NA | 1.77E-06 | mr1553_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141321523 | NA | 1.77E-08 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141321523 | NA | 4.71E-06 | mr1974_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |