\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141183119:

Variant ID: vg0141183119 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41183119
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.26, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


GATAAAAACTCAATGGAAAGTTTATATGAGGTAGAACCTTATGTTAGTTTTTCTCCAAAACTTGGCATTAGGTATTTCATAGGTTTCTATAGAATTTATT[T/C]
ATTTGATTCAAAGGGCTATATAGAAAAAATTCCTATAGGAATGAAATTCTCTAAAATTCATATGAGACCTTGTTTAGATCCCAAAAAATTTTGGCCAAAA

Reverse complement sequence

TTTTGGCCAAAATTTTTTGGGATCTAAACAAGGTCTCATATGAATTTTAGAGAATTTCATTCCTATAGGAATTTTTTCTATATAGCCCTTTGAATCAAAT[A/G]
AATAAATTCTATAGAAACCTATGAAATACCTAATGCCAAGTTTTGGAGAAAAACTAACATAAGGTTCTACCTCATATAAACTTTCCATTGAGTTTTTATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.10% 39.70% 0.21% 0.00% NA
All Indica  2759 92.90% 6.90% 0.18% 0.00% NA
All Japonica  1512 2.80% 97.10% 0.13% 0.00% NA
Aus  269 66.20% 33.50% 0.37% 0.00% NA
Indica I  595 93.30% 5.90% 0.84% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 94.40% 5.60% 0.00% 0.00% NA
Indica Intermediate  786 88.00% 12.00% 0.00% 0.00% NA
Temperate Japonica  767 1.00% 98.70% 0.26% 0.00% NA
Tropical Japonica  504 4.60% 95.40% 0.00% 0.00% NA
Japonica Intermediate  241 4.60% 95.40% 0.00% 0.00% NA
VI/Aromatic  96 17.70% 82.30% 0.00% 0.00% NA
Intermediate  90 41.10% 56.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141183119 T -> C LOC_Os01g71180.1 upstream_gene_variant ; 681.0bp to feature; MODIFIER silent_mutation Average:48.472; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0141183119 T -> C LOC_Os01g71190.1 upstream_gene_variant ; 3855.0bp to feature; MODIFIER silent_mutation Average:48.472; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0141183119 T -> C LOC_Os01g71170.1 downstream_gene_variant ; 2752.0bp to feature; MODIFIER silent_mutation Average:48.472; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0141183119 T -> C LOC_Os01g71170-LOC_Os01g71180 intergenic_region ; MODIFIER silent_mutation Average:48.472; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141183119 NA 1.86E-25 mr1024_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 1.22E-12 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 2.44E-30 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 2.40E-06 NA mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 1.15E-16 mr1148_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 3.13E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 4.33E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 1.85E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 5.60E-35 mr1256_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 3.64E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 1.01E-06 NA mr1504_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 5.99E-14 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 5.18E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 3.90E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 1.21E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 3.42E-06 NA mr1670_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 7.39E-08 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 2.46E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 4.38E-34 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 8.89E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 4.02E-32 mr1873_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 2.10E-08 NA mr1889_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 1.82E-06 NA mr1896_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 1.57E-06 NA mr1907_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141183119 NA 2.68E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251