Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0141182631:

Variant ID: vg0141182631 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41182631
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACTCAAAAAGACAAGTAATATGGGACGCAGGTAGTATGTTTTAGCCCCTCTCTCCCAAACACCCCCTTAGTTACTGTGGTGCATGGCCTAGTCTAGCA[T/C]
TAGGCAAGATACTAAGCACTTGATTGAGCAGTATTGATGAGACTGGGATCGCTGTATATGTGTAGTTGGGCTTAGAACTTTATTACTCGGGCCTAGGGTT

Reverse complement sequence

AACCCTAGGCCCGAGTAATAAAGTTCTAAGCCCAACTACACATATACAGCGATCCCAGTCTCATCAATACTGCTCAATCAAGTGCTTAGTATCTTGCCTA[A/G]
TGCTAGACTAGGCCATGCACCACAGTAACTAAGGGGGTGTTTGGGAGAGAGGGGCTAAAACATACTACCTGCGTCCCATATTACTTGTCTTTTTGAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.60%	4.30%	14.66%	5.46%	NA
All Indica	2759	66.00%	0.70%	24.18%	9.21%	NA
All Japonica	1512	97.90%	1.10%	0.79%	0.13%	NA
Aus	269	36.80%	62.50%	0.74%	0.00%	NA
Indica I	595	71.60%	0.20%	24.20%	4.03%	NA
Indica II	465	41.10%	0.20%	42.37%	16.34%	NA
Indica III	913	73.60%	0.30%	15.99%	10.08%	NA
Indica Intermediate	786	67.60%	1.70%	22.90%	7.89%	NA
Temperate Japonica	767	99.90%	0.00%	0.13%	0.00%	NA
Tropical Japonica	504	96.80%	1.40%	1.59%	0.20%	NA
Japonica Intermediate	241	94.20%	4.10%	1.24%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	85.60%	0.00%	12.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141182631	T -> DEL	N	N	silent_mutation	Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995	N	N	N	N
vg0141182631	T -> C	LOC_Os01g71180.1	upstream_gene_variant ; 1169.0bp to feature; MODIFIER	silent_mutation	Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995	N	N	N	N
vg0141182631	T -> C	LOC_Os01g71190.1	upstream_gene_variant ; 4343.0bp to feature; MODIFIER	silent_mutation	Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995	N	N	N	N
vg0141182631	T -> C	LOC_Os01g71160.1	downstream_gene_variant ; 4808.0bp to feature; MODIFIER	silent_mutation	Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995	N	N	N	N
vg0141182631	T -> C	LOC_Os01g71170.1	downstream_gene_variant ; 2264.0bp to feature; MODIFIER	silent_mutation	Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995	N	N	N	N
vg0141182631	T -> C	LOC_Os01g71170-LOC_Os01g71180	intergenic_region ; MODIFIER	silent_mutation	Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0141182631	T	C	-0.01	0.03	0.02	0.05	0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141182631	NA	2.22E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631	NA	5.69E-06	mr1523	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631	3.10E-06	6.57E-40	mr1549	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631	2.06E-08	2.34E-46	mr1550	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631	3.81E-07	4.16E-41	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631	NA	1.12E-06	mr1931	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631	1.88E-07	NA	mr1098_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631	NA	6.05E-09	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631	NA	5.87E-34	mr1549_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631	1.86E-07	1.98E-49	mr1550_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631	7.16E-07	4.09E-31	mr1757_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631	NA	1.72E-07	mr1762_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251