\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141182631:

Variant ID: vg0141182631 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41182631
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACTCAAAAAGACAAGTAATATGGGACGCAGGTAGTATGTTTTAGCCCCTCTCTCCCAAACACCCCCTTAGTTACTGTGGTGCATGGCCTAGTCTAGCA[T/C]
TAGGCAAGATACTAAGCACTTGATTGAGCAGTATTGATGAGACTGGGATCGCTGTATATGTGTAGTTGGGCTTAGAACTTTATTACTCGGGCCTAGGGTT

Reverse complement sequence

AACCCTAGGCCCGAGTAATAAAGTTCTAAGCCCAACTACACATATACAGCGATCCCAGTCTCATCAATACTGCTCAATCAAGTGCTTAGTATCTTGCCTA[A/G]
TGCTAGACTAGGCCATGCACCACAGTAACTAAGGGGGTGTTTGGGAGAGAGGGGCTAAAACATACTACCTGCGTCCCATATTACTTGTCTTTTTGAGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 4.30% 14.66% 5.46% NA
All Indica  2759 66.00% 0.70% 24.18% 9.21% NA
All Japonica  1512 97.90% 1.10% 0.79% 0.13% NA
Aus  269 36.80% 62.50% 0.74% 0.00% NA
Indica I  595 71.60% 0.20% 24.20% 4.03% NA
Indica II  465 41.10% 0.20% 42.37% 16.34% NA
Indica III  913 73.60% 0.30% 15.99% 10.08% NA
Indica Intermediate  786 67.60% 1.70% 22.90% 7.89% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 96.80% 1.40% 1.59% 0.20% NA
Japonica Intermediate  241 94.20% 4.10% 1.24% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 85.60% 0.00% 12.22% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141182631 T -> DEL N N silent_mutation Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995 N N N N
vg0141182631 T -> C LOC_Os01g71180.1 upstream_gene_variant ; 1169.0bp to feature; MODIFIER silent_mutation Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995 N N N N
vg0141182631 T -> C LOC_Os01g71190.1 upstream_gene_variant ; 4343.0bp to feature; MODIFIER silent_mutation Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995 N N N N
vg0141182631 T -> C LOC_Os01g71160.1 downstream_gene_variant ; 4808.0bp to feature; MODIFIER silent_mutation Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995 N N N N
vg0141182631 T -> C LOC_Os01g71170.1 downstream_gene_variant ; 2264.0bp to feature; MODIFIER silent_mutation Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995 N N N N
vg0141182631 T -> C LOC_Os01g71170-LOC_Os01g71180 intergenic_region ; MODIFIER silent_mutation Average:75.743; most accessible tissue: Zhenshan97 flower, score: 94.995 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0141182631 T C -0.01 0.03 0.02 0.05 0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141182631 NA 2.22E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631 NA 5.69E-06 mr1523 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631 3.10E-06 6.57E-40 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631 2.06E-08 2.34E-46 mr1550 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631 3.81E-07 4.16E-41 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631 NA 1.12E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631 1.88E-07 NA mr1098_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631 NA 6.05E-09 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631 NA 5.87E-34 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631 1.86E-07 1.98E-49 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631 7.16E-07 4.09E-31 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141182631 NA 1.72E-07 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251