\
| Variant ID: vg0141124773 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 41124773 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 116. )
TGCAACATTATTAATATCATCATAATATAGAAATTGAAATGTACATGATGCAATATTTACAGTTGTATACATAAAAACGATTATCAATGCTAAATACTAG[T/C]
AGTACAATATAACGAACAACCAACCCCGCCAATGTTTCACTAGCACTCCTATGTCATTATAAAAAAATGTATTATTAGAGTGTGTTGAGAGAAGGAGAAA
TTTCTCCTTCTCTCAACACACTCTAATAATACATTTTTTTATAATGACATAGGAGTGCTAGTGAAACATTGGCGGGGTTGGTTGTTCGTTATATTGTACT[A/G]
CTAGTATTTAGCATTGATAATCGTTTTTATGTATACAACTGTAAATATTGCATCATGTACATTTCAATTTCTATATTATGATGATATTAATAATGTTGCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.40% | 36.50% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 39.80% | 60.10% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 59.80% | 40.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 12.50% | 87.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 33.60% | 66.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 48.00% | 51.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 26.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0141124773 | T -> C | LOC_Os01g71050.1 | upstream_gene_variant ; 2461.0bp to feature; MODIFIER | silent_mutation | Average:55.646; most accessible tissue: Callus, score: 85.969 | N | N | N | N |
| vg0141124773 | T -> C | LOC_Os01g71060.1 | downstream_gene_variant ; 1321.0bp to feature; MODIFIER | silent_mutation | Average:55.646; most accessible tissue: Callus, score: 85.969 | N | N | N | N |
| vg0141124773 | T -> C | LOC_Os01g71050-LOC_Os01g71060 | intergenic_region ; MODIFIER | silent_mutation | Average:55.646; most accessible tissue: Callus, score: 85.969 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0141124773 | NA | 1.29E-10 | Grain_width | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0141124773 | NA | 7.55E-09 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141124773 | 3.84E-06 | 3.61E-06 | mr1985 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141124773 | 2.88E-06 | 2.88E-06 | mr1985 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141124773 | NA | 6.74E-06 | mr1974_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |