Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141124773:

Variant ID: vg0141124773 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41124773
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

TGCAACATTATTAATATCATCATAATATAGAAATTGAAATGTACATGATGCAATATTTACAGTTGTATACATAAAAACGATTATCAATGCTAAATACTAG[T/C]
AGTACAATATAACGAACAACCAACCCCGCCAATGTTTCACTAGCACTCCTATGTCATTATAAAAAAATGTATTATTAGAGTGTGTTGAGAGAAGGAGAAA

Reverse complement sequence

TTTCTCCTTCTCTCAACACACTCTAATAATACATTTTTTTATAATGACATAGGAGTGCTAGTGAAACATTGGCGGGGTTGGTTGTTCGTTATATTGTACT[A/G]
CTAGTATTTAGCATTGATAATCGTTTTTATGTATACAACTGTAAATATTGCATCATGTACATTTCAATTTCTATATTATGATGATATTAATAATGTTGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	36.50%	0.11%	0.00%	NA
All Indica	2759	39.80%	60.10%	0.14%	0.00%	NA
All Japonica	1512	97.40%	2.60%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	59.80%	40.00%	0.17%	0.00%	NA
Indica II	465	12.50%	87.30%	0.22%	0.00%	NA
Indica III	913	33.60%	66.40%	0.00%	0.00%	NA
Indica Intermediate	786	48.00%	51.80%	0.25%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	94.60%	5.40%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	26.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141124773	T -> C	LOC_Os01g71050.1	upstream_gene_variant ; 2461.0bp to feature; MODIFIER	silent_mutation	Average:55.646; most accessible tissue: Callus, score: 85.969	N	N	N	N
vg0141124773	T -> C	LOC_Os01g71060.1	downstream_gene_variant ; 1321.0bp to feature; MODIFIER	silent_mutation	Average:55.646; most accessible tissue: Callus, score: 85.969	N	N	N	N
vg0141124773	T -> C	LOC_Os01g71050-LOC_Os01g71060	intergenic_region ; MODIFIER	silent_mutation	Average:55.646; most accessible tissue: Callus, score: 85.969	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141124773	NA	1.29E-10	Grain_width	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141124773	NA	7.55E-09	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141124773	3.84E-06	3.61E-06	mr1985	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141124773	2.88E-06	2.88E-06	mr1985	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141124773	NA	6.74E-06	mr1974_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251