\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141124773:

Variant ID: vg0141124773 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 41124773
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


TGCAACATTATTAATATCATCATAATATAGAAATTGAAATGTACATGATGCAATATTTACAGTTGTATACATAAAAACGATTATCAATGCTAAATACTAG[T/C]
AGTACAATATAACGAACAACCAACCCCGCCAATGTTTCACTAGCACTCCTATGTCATTATAAAAAAATGTATTATTAGAGTGTGTTGAGAGAAGGAGAAA

Reverse complement sequence

TTTCTCCTTCTCTCAACACACTCTAATAATACATTTTTTTATAATGACATAGGAGTGCTAGTGAAACATTGGCGGGGTTGGTTGTTCGTTATATTGTACT[A/G]
CTAGTATTTAGCATTGATAATCGTTTTTATGTATACAACTGTAAATATTGCATCATGTACATTTCAATTTCTATATTATGATGATATTAATAATGTTGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 36.50% 0.11% 0.00% NA
All Indica  2759 39.80% 60.10% 0.14% 0.00% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 59.80% 40.00% 0.17% 0.00% NA
Indica II  465 12.50% 87.30% 0.22% 0.00% NA
Indica III  913 33.60% 66.40% 0.00% 0.00% NA
Indica Intermediate  786 48.00% 51.80% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 94.60% 5.40% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0141124773 T -> C LOC_Os01g71050.1 upstream_gene_variant ; 2461.0bp to feature; MODIFIER silent_mutation Average:55.646; most accessible tissue: Callus, score: 85.969 N N N N
vg0141124773 T -> C LOC_Os01g71060.1 downstream_gene_variant ; 1321.0bp to feature; MODIFIER silent_mutation Average:55.646; most accessible tissue: Callus, score: 85.969 N N N N
vg0141124773 T -> C LOC_Os01g71050-LOC_Os01g71060 intergenic_region ; MODIFIER silent_mutation Average:55.646; most accessible tissue: Callus, score: 85.969 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0141124773 NA 1.29E-10 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0141124773 NA 7.55E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141124773 3.84E-06 3.61E-06 mr1985 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141124773 2.88E-06 2.88E-06 mr1985 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141124773 NA 6.74E-06 mr1974_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251