\
| Variant ID: vg0141089936 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 41089936 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )
TCCCCTCCGGCCAAAAGCAAAGCTAGAGAAAAAAATCCAAGTACTAAACCTCTAATAAGCGCACAACATTCCCAATCAGTGCCAGAGGCTGTTTATTAGA[G/A]
TTTCAACTTCTAAATTTAGCTTCAGTAGTTAGATCTATAGTAGAGTTGTGGAGCGGCCTAAACCCAACTCCAACTCTCTAGTTCAGTTTGTGAGAGAGCC
GGCTCTCTCACAAACTGAACTAGAGAGTTGGAGTTGGGTTTAGGCCGCTCCACAACTCTACTATAGATCTAACTACTGAAGCTAAATTTAGAAGTTGAAA[C/T]
TCTAATAAACAGCCTCTGGCACTGATTGGGAATGTTGTGCGCTTATTAGAGGTTTAGTACTTGGATTTTTTTCTCTAGCTTTGCTTTTGGCCGGAGGGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 3.90% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 93.10% | 6.20% | 0.72% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 84.40% | 13.60% | 2.02% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.10% | 8.90% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0141089936 | G -> A | LOC_Os01g70980.1 | upstream_gene_variant ; 1768.0bp to feature; MODIFIER | silent_mutation | Average:57.535; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0141089936 | G -> A | LOC_Os01g70990.1 | upstream_gene_variant ; 367.0bp to feature; MODIFIER | silent_mutation | Average:57.535; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0141089936 | G -> A | LOC_Os01g70980-LOC_Os01g70990 | intergenic_region ; MODIFIER | silent_mutation | Average:57.535; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0141089936 | NA | 2.91E-06 | mr1038 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 1.67E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 5.44E-06 | mr1177 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 2.81E-06 | mr1376 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 3.17E-10 | mr1389 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 3.32E-09 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 2.81E-06 | mr1431 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 6.03E-08 | mr1611 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | 2.89E-06 | 1.07E-07 | mr1636 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 2.00E-06 | mr1706 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 6.10E-12 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 3.50E-11 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 7.87E-10 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0141089936 | NA | 1.99E-09 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |