Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0141059016:

Variant ID: vg0141059016 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 41059016
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:

ATCACCGCCGTCCATTCTGAATTGGTAACTACTGTACCAATTAGCGACAGTTCAAAATTAGTTGCATAATTTCTGTCTTGTTTGGAGATGACTCTGCGTC[G/A]
GACATCCGATATTCCATCAAATATCGGACGCATGATGTTTGCGTGTCATCACACCACCTGCGTATGCAGCATGACCAAAAAAAAATTGGTCCGTCAAATG

Reverse complement sequence

CATTTGACGGACCAATTTTTTTTTGGTCATGCTGCATACGCAGGTGGTGTGATGACACGCAAACATCATGCGTCCGATATTTGATGGAATATCGGATGTC[C/T]
GACGCAGAGTCATCTCCAAACAAGACAGAAATTATGCAACTAATTTTGAACTGTCGCTAATTGGTACAGTAGTTACCAATTCAGAATGGACGGCGGTGAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.60%	47.30%	0.06%	0.00%	NA
All Indica	2759	21.50%	78.50%	0.04%	0.00%	NA
All Japonica	1512	98.10%	1.80%	0.07%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	15.10%	84.90%	0.00%	0.00%	NA
Indica II	465	2.80%	97.20%	0.00%	0.00%	NA
Indica III	913	30.30%	69.60%	0.11%	0.00%	NA
Indica Intermediate	786	27.00%	73.00%	0.00%	0.00%	NA
Temperate Japonica	767	98.80%	1.20%	0.00%	0.00%	NA
Tropical Japonica	504	97.20%	2.60%	0.20%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	63.30%	35.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0141059016	G -> A	LOC_Os01g70930.1	upstream_gene_variant ; 144.0bp to feature; MODIFIER	silent_mutation	Average:78.87; most accessible tissue: Callus, score: 89.019	N	N	N	N
vg0141059016	G -> A	LOC_Os01g70940.1	upstream_gene_variant ; 2075.0bp to feature; MODIFIER	silent_mutation	Average:78.87; most accessible tissue: Callus, score: 89.019	N	N	N	N
vg0141059016	G -> A	LOC_Os01g70940.2	upstream_gene_variant ; 2075.0bp to feature; MODIFIER	silent_mutation	Average:78.87; most accessible tissue: Callus, score: 89.019	N	N	N	N
vg0141059016	G -> A	LOC_Os01g70940.3	upstream_gene_variant ; 2075.0bp to feature; MODIFIER	silent_mutation	Average:78.87; most accessible tissue: Callus, score: 89.019	N	N	N	N
vg0141059016	G -> A	LOC_Os01g70920.1	downstream_gene_variant ; 2367.0bp to feature; MODIFIER	silent_mutation	Average:78.87; most accessible tissue: Callus, score: 89.019	N	N	N	N
vg0141059016	G -> A	LOC_Os01g70920.2	downstream_gene_variant ; 2367.0bp to feature; MODIFIER	silent_mutation	Average:78.87; most accessible tissue: Callus, score: 89.019	N	N	N	N
vg0141059016	G -> A	LOC_Os01g70920.3	downstream_gene_variant ; 2367.0bp to feature; MODIFIER	silent_mutation	Average:78.87; most accessible tissue: Callus, score: 89.019	N	N	N	N
vg0141059016	G -> A	LOC_Os01g70930-LOC_Os01g70940	intergenic_region ; MODIFIER	silent_mutation	Average:78.87; most accessible tissue: Callus, score: 89.019	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0141059016	NA	3.14E-20	mr1244	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	5.10E-11	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	6.05E-51	mr1458	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	2.38E-07	mr1458	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	5.02E-06	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	1.30E-49	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	6.23E-22	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	2.11E-15	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	8.75E-21	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	1.72E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	2.48E-21	mr1218_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	6.73E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	8.48E-35	mr1221_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	3.48E-24	mr1244_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	1.04E-16	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	7.00E-09	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	1.91E-08	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	2.60E-28	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	1.60E-13	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	2.42E-17	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	5.15E-24	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	2.03E-18	mr1454_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	9.92E-07	mr1454_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	1.39E-19	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	1.13E-58	mr1458_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	1.32E-09	mr1458_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	1.09E-08	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	6.03E-30	mr1580_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	5.23E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	3.87E-68	mr1798_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	5.90E-30	mr1825_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	4.61E-06	NA	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	4.09E-07	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	9.88E-07	NA	mr1908_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0141059016	NA	3.88E-07	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251