\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140957424:

Variant ID: vg0140957424 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 40957424
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATAATATCTGAAACAATCCTCCAGCATTGTCAGCCAAAAATATCCAGCACGTCGGAGCAACCACTTTATTTTATGAGCCTACTGATGTGTACCACAT[T/A]
TCCCTTCATGAACTTCGCCGATTGCAACTTTTGCCTGATCGGCACTCAAACATTTAAGCAACACCCCATCAATCGTCCGATAATAGAGGTCATCATCCAA

Reverse complement sequence

TTGGATGATGACCTCTATTATCGGACGATTGATGGGGTGTTGCTTAAATGTTTGAGTGCCGATCAGGCAAAAGTTGCAATCGGCGAAGTTCATGAAGGGA[A/T]
ATGTGGTACACATCAGTAGGCTCATAAAATAAAGTGGTTGCTCCGACGTGCTGGATATTTTTGGCTGACAATGCTGGAGGATTGTTTCAGATATTATAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.30% 36.90% 4.72% 0.00% NA
All Indica  2759 43.50% 49.30% 7.14% 0.00% NA
All Japonica  1512 98.50% 0.90% 0.60% 0.00% NA
Aus  269 2.60% 93.70% 3.72% 0.00% NA
Indica I  595 42.50% 50.30% 7.23% 0.00% NA
Indica II  465 71.00% 17.00% 12.04% 0.00% NA
Indica III  913 26.10% 69.90% 4.05% 0.00% NA
Indica Intermediate  786 48.30% 43.90% 7.76% 0.00% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 98.60% 0.60% 0.79% 0.00% NA
Japonica Intermediate  241 95.40% 2.50% 2.07% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 61.10% 31.10% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140957424 T -> A LOC_Os01g70750.1 downstream_gene_variant ; 1685.0bp to feature; MODIFIER silent_mutation Average:28.567; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 N N N N
vg0140957424 T -> A LOC_Os01g70770.1 downstream_gene_variant ; 4977.0bp to feature; MODIFIER silent_mutation Average:28.567; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 N N N N
vg0140957424 T -> A LOC_Os01g70760.1 intron_variant ; MODIFIER silent_mutation Average:28.567; most accessible tissue: Zhenshan97 flag leaf, score: 39.979 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140957424 NA 1.55E-82 mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 5.03E-22 mr1168 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 7.20E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 2.58E-25 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 4.99E-18 mr1529 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 2.85E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 2.99E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 2.86E-16 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 1.35E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 7.21E-61 mr1711 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 1.64E-25 mr1731 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 6.12E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 2.22E-101 mr1134_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 1.11E-18 mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 1.24E-20 mr1298_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 9.01E-20 mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 3.80E-15 mr1529_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 9.52E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 6.10E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 1.00E-11 mr1641_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 1.02E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 9.22E-87 mr1711_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 1.09E-19 mr1731_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 1.18E-08 3.27E-06 mr1750_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 2.93E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140957424 NA 5.46E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251