\
| Variant ID: vg0140952929 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 40952929 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 236. )
GGCGATTCCACTCCCGGCCAGATCTTCACCCGCGACGATGTCGACCTCCACCAATCCAACCGCCGCATCATCAGCCGAATATGCTGAGGTAAGTCCCCAT[T/C]
GGCTAGATCCCCTTTTCCGTTCATCAGACCGGTTTTCGCTCACCTTATCTTGTTTCCTTCTTCTCTATTCTTGTAGCATCTTTCCAATCTTGTTGCGGTT
AACCGCAACAAGATTGGAAAGATGCTACAAGAATAGAGAAGAAGGAAACAAGATAAGGTGAGCGAAAACCGGTCTGATGAACGGAAAAGGGGATCTAGCC[A/G]
ATGGGGACTTACCTCAGCATATTCGGCTGATGATGCGGCGGTTGGATTGGTGGAGGTCGACATCGTCGCGGGTGAAGATCTGGCCGGGAGTGGAATCGCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.70% | 37.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 3.40% | 96.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 68.40% | 31.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.70% | 96.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0140952929 | T -> C | LOC_Os01g70740.1 | upstream_gene_variant ; 3336.0bp to feature; MODIFIER | silent_mutation | Average:30.971; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| vg0140952929 | T -> C | LOC_Os01g70760.1 | downstream_gene_variant ; 3426.0bp to feature; MODIFIER | silent_mutation | Average:30.971; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| vg0140952929 | T -> C | LOC_Os01g70750.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.971; most accessible tissue: Zhenshan97 flag leaf, score: 53.034 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0140952929 | NA | 3.22E-28 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | 8.71E-06 | NA | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | NA | 1.70E-23 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | 7.32E-06 | NA | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | NA | 4.98E-06 | mr1511 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | NA | 9.47E-08 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | NA | 3.26E-08 | mr1660 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | 6.39E-06 | 3.93E-37 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | NA | 6.30E-07 | mr1781 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | NA | 2.71E-26 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | NA | 4.70E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | 3.53E-07 | 6.18E-50 | mr1670_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140952929 | NA | 3.57E-11 | mr1781_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |