Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140900473:

Variant ID: vg0140900473 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 40900473
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTTCTCAAGGATGATAAAATTACCCTATTGTTTTACCCTTATATTCCTGATAAAATCTTGTGTCTTTTCTATTACTCTTTTTTTCTCTTCATCCCTAC[G/A]
ATTCAAAAAGACAGATGATGTCATGTGTTCAAATGGTTCTCCATATTAGAATTCGGTGGGTTATTTATTCATTGTGTTTCCTGCAAGCAAAACTGGATTA

Reverse complement sequence

TAATCCAGTTTTGCTTGCAGGAAACACAATGAATAAATAACCCACCGAATTCTAATATGGAGAACCATTTGAACACATGACATCATCTGTCTTTTTGAAT[C/T]
GTAGGGATGAAGAGAAAAAAAGAGTAATAGAAAAGACACAAGATTTTATCAGGAATATAAGGGTAAAACAATAGGGTAATTTTATCATCCTTGAGAAGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.70%	5.10%	0.13%	6.05%	NA
All Indica	2759	95.50%	1.60%	0.14%	2.79%	NA
All Japonica	1512	95.30%	0.40%	0.13%	4.17%	NA
Aus	269	12.60%	33.10%	0.00%	54.28%	NA
Indica I	595	95.00%	0.00%	0.17%	4.87%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	96.60%	3.10%	0.00%	0.33%	NA
Indica Intermediate	786	92.00%	2.00%	0.38%	5.60%	NA
Temperate Japonica	767	99.60%	0.00%	0.00%	0.39%	NA
Tropical Japonica	504	95.40%	0.00%	0.00%	4.56%	NA
Japonica Intermediate	241	81.30%	2.50%	0.83%	15.35%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0140900473	G -> A	LOC_Os01g70640.1	downstream_gene_variant ; 1977.0bp to feature; MODIFIER	silent_mutation	Average:24.832; most accessible tissue: Callus, score: 55.196	N	N	N	N
vg0140900473	G -> A	LOC_Os01g70650.1	downstream_gene_variant ; 627.0bp to feature; MODIFIER	silent_mutation	Average:24.832; most accessible tissue: Callus, score: 55.196	N	N	N	N
vg0140900473	G -> A	LOC_Os01g70660.1	downstream_gene_variant ; 2020.0bp to feature; MODIFIER	silent_mutation	Average:24.832; most accessible tissue: Callus, score: 55.196	N	N	N	N
vg0140900473	G -> A	LOC_Os01g70650-LOC_Os01g70660	intergenic_region ; MODIFIER	silent_mutation	Average:24.832; most accessible tissue: Callus, score: 55.196	N	N	N	N
vg0140900473	G -> DEL	N	N	silent_mutation	Average:24.832; most accessible tissue: Callus, score: 55.196	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0140900473	8.54E-07	NA	mr1134_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140900473	NA	1.17E-07	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140900473	9.16E-07	NA	mr1750_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251