\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140894558:

Variant ID: vg0140894558 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 40894558
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTATAAATTATATTCCTATATAAACACACACTATATTCCTGGACCCGTTTGGACTTTCAAAAAACTACTGTTTGTTTAATGTTAATTGCCACTAGTGCT[A/C]
GTACATCTGCTAATTGCATGGTAAGGCAGCTGAAGGCCACGTCTATACAGCATGCTTACCCGAGTCAACGTGTTGAGTACTACTTGGGTACCTGCTGCAC

Reverse complement sequence

GTGCAGCAGGTACCCAAGTAGTACTCAACACGTTGACTCGGGTAAGCATGCTGTATAGACGTGGCCTTCAGCTGCCTTACCATGCAATTAGCAGATGTAC[T/G]
AGCACTAGTGGCAATTAACATTAAACAAACAGTAGTTTTTTGAAAGTCCAAACGGGTCCAGGAATATAGTGTGTGTTTATATAGGAATATAATTTATAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 5.10% 0.04% 0.00% NA
All Indica  2759 98.20% 1.80% 0.07% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 68.40% 31.60% 0.00% 0.00% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 96.80% 3.20% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140894558 A -> C LOC_Os01g70640.1 upstream_gene_variant ; 3095.0bp to feature; MODIFIER silent_mutation Average:66.346; most accessible tissue: Callus, score: 96.145 N N N N
vg0140894558 A -> C LOC_Os01g70650.1 upstream_gene_variant ; 4863.0bp to feature; MODIFIER silent_mutation Average:66.346; most accessible tissue: Callus, score: 96.145 N N N N
vg0140894558 A -> C LOC_Os01g70630.1 downstream_gene_variant ; 3099.0bp to feature; MODIFIER silent_mutation Average:66.346; most accessible tissue: Callus, score: 96.145 N N N N
vg0140894558 A -> C LOC_Os01g70630-LOC_Os01g70640 intergenic_region ; MODIFIER silent_mutation Average:66.346; most accessible tissue: Callus, score: 96.145 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140894558 7.94E-07 NA mr1008 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140894558 3.23E-06 NA mr1009 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140894558 3.07E-06 NA mr1134 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140894558 NA 4.12E-09 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251