\
| Variant ID: vg0140888404 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 40888404 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTATGCGCATACATTGCGCCTTTTTGGAGTATTTTTTGGGCATAATAATAATGGCCATTTTAAGAGTAGCTTGTTTTTGGTACTTGCAGTTGCCATTGTG[G/A]
TATTCTTTTGTTCTTATAGTGGTAAGTGTTTTTCTGATTTTGTTAACGTGTGTCTGTTCCTTTTTTTTTTTGCATTTGTGTTTGTTGCATTCATCTCTTA
TAAGAGATGAATGCAACAAACACAAATGCAAAAAAAAAAAGGAACAGACACACGTTAACAAAATCAGAAAAACACTTACCACTATAAGAACAAAAGAATA[C/T]
CACAATGGCAACTGCAAGTACCAAAAACAAGCTACTCTTAAAATGGCCATTATTATTATGCCCAAAAAATACTCCAAAAAGGCGCAATGTATGCGCATAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.20% | 7.20% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 2.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 91.80% | 6.50% | 1.65% | 0.00% | NA |
| Aus | 269 | 69.10% | 30.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.80% | 3.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 94.70% | 4.40% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 93.70% | 5.40% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 78.80% | 15.80% | 5.39% | 0.00% | NA |
| VI/Aromatic | 96 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0140888404 | G -> A | LOC_Os01g70630.1 | N | stop_gained | Average:17.111; most accessible tissue: Minghui63 panicle, score: 25.313 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0140888404 | 7.42E-06 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 2.32E-06 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 9.31E-07 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 7.90E-06 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 2.10E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 7.88E-07 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 7.00E-06 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 4.41E-06 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 2.48E-06 | 2.48E-06 | mr1373_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 4.08E-06 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 8.58E-06 | 8.58E-06 | mr1652_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | NA | 8.32E-08 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 8.50E-06 | 8.50E-06 | mr1832_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | NA | 7.26E-06 | mr1833_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 4.18E-06 | 4.18E-06 | mr1843_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | NA | 1.75E-07 | mr1851_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888404 | 2.47E-06 | NA | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |