\
| Variant ID: vg0140888130 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 40888130 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.02, others allele: 0.00, population size: 209. )
CCTGTTTTTACTCATGGTCAGTTATATGTTGCCTTCTCAAGGGCAACTTCTCGATCAGGCTTACGAATATTGATTGAAAATGATGATGGCTCATGCGGAT[T/C]
AGAAACAAAAAACGTAGTTTACCATGAAATCCTGGATGCTACGTTAGCAGCGGTAATATGTTGCGTCTTTTTTAACTTCTGCAAATCTCCTTCATTGATA
TATCAATGAAGGAGATTTGCAGAAGTTAAAAAAGACGCAACATATTACCGCTGCTAACGTAGCATCCAGGATTTCATGGTAAACTACGTTTTTTGTTTCT[A/G]
ATCCGCATGAGCCATCATCATTTTCAATCAATATTCGTAAGCCTGATCGAGAAGTTGCCCTTGAGAAGGCAACATATAACTGACCATGAGTAAAAACAGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 7.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 97.90% | 2.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 93.60% | 6.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 68.80% | 31.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.70% | 3.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 79.70% | 20.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 13.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0140888130 | T -> C | LOC_Os01g70630.1 | missense_variant ; p.Leu360Ser; MODERATE | nonsynonymous_codon ; L360S | Average:21.103; most accessible tissue: Zhenshan97 panicle, score: 36.038 | possibly damaging |
-1.746 |
TOLERATED | 0.82 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0140888130 | 4.80E-07 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 1.49E-06 | NA | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 2.81E-06 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 1.61E-07 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 9.46E-09 | NA | mr1117_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 4.43E-06 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 7.70E-08 | NA | mr1119_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 4.32E-07 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 2.82E-06 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 1.71E-06 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 2.45E-06 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 4.12E-07 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 4.63E-06 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 3.47E-06 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | NA | 2.98E-08 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | NA | 2.08E-07 | mr1808_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140888130 | 2.12E-06 | NA | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |