\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140883886:

Variant ID: vg0140883886 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 40883886
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


CCTTGCTTGCGTTGGTCAGGTATCCTTCCAGCCGAGCACCATGGACGGGAGGGACAACTTGTGCCTTGTAGACAAGATAGTTCCCCTTTTCAATTTTTCT[G/A]
CGATGACATGGCCAGCAAGAGAGTTCACAGCGACATTGGAAGAGCTCGCCATGTTTGCTACTTGTGATTTTAGTGGAGTTGCGGTTCTGATCGTCTATAT

Reverse complement sequence

ATATAGACGATCAGAACCGCAACTCCACTAAAATCACAAGTAGCAAACATGGCGAGCTCTTCCAATGTCGCTGTGAACTCTCTTGCTGGCCATGTCATCG[C/T]
AGAAAAATTGAAAAGGGGAACTATCTTGTCTACAAGGCACAAGTTGTCCCTCCCGTCCATGGTGCTCGGCTGGAAGGATACCTGACCAACGCAAGCAAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 7.20% 0.08% 0.00% NA
All Indica  2759 97.90% 2.10% 0.04% 0.00% NA
All Japonica  1512 93.60% 6.40% 0.00% 0.00% NA
Aus  269 68.00% 31.60% 0.37% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 96.80% 3.20% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.30% 0.13% 0.00% NA
Temperate Japonica  767 97.80% 2.20% 0.00% 0.00% NA
Tropical Japonica  504 93.80% 6.20% 0.00% 0.00% NA
Japonica Intermediate  241 79.70% 20.30% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 92.70% 1.04% 0.00% NA
Intermediate  90 85.60% 13.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140883886 G -> A LOC_Os01g70630.1 upstream_gene_variant ; 680.0bp to feature; MODIFIER silent_mutation Average:40.281; most accessible tissue: Zhenshan97 young leaf, score: 64.205 N N N N
vg0140883886 G -> A LOC_Os01g70600.1 downstream_gene_variant ; 2705.0bp to feature; MODIFIER silent_mutation Average:40.281; most accessible tissue: Zhenshan97 young leaf, score: 64.205 N N N N
vg0140883886 G -> A LOC_Os01g70610.1 downstream_gene_variant ; 1787.0bp to feature; MODIFIER silent_mutation Average:40.281; most accessible tissue: Zhenshan97 young leaf, score: 64.205 N N N N
vg0140883886 G -> A LOC_Os01g70620.1 downstream_gene_variant ; 483.0bp to feature; MODIFIER silent_mutation Average:40.281; most accessible tissue: Zhenshan97 young leaf, score: 64.205 N N N N
vg0140883886 G -> A LOC_Os01g70620-LOC_Os01g70630 intergenic_region ; MODIFIER silent_mutation Average:40.281; most accessible tissue: Zhenshan97 young leaf, score: 64.205 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140883886 2.41E-06 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 1.22E-06 NA mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 NA 1.93E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 4.15E-07 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 4.17E-08 NA mr1114_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 3.28E-08 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 5.87E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 1.06E-07 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 1.12E-07 NA mr1120_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 4.44E-06 NA mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 1.84E-06 NA mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 1.15E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 4.00E-07 NA mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 1.71E-06 NA mr1495_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 NA 2.37E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 NA 3.28E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886 9.40E-08 NA mr1961_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251