Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140883886:

Variant ID: vg0140883886 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 40883886
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.02, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:

CCTTGCTTGCGTTGGTCAGGTATCCTTCCAGCCGAGCACCATGGACGGGAGGGACAACTTGTGCCTTGTAGACAAGATAGTTCCCCTTTTCAATTTTTCT[G/A]
CGATGACATGGCCAGCAAGAGAGTTCACAGCGACATTGGAAGAGCTCGCCATGTTTGCTACTTGTGATTTTAGTGGAGTTGCGGTTCTGATCGTCTATAT

Reverse complement sequence

ATATAGACGATCAGAACCGCAACTCCACTAAAATCACAAGTAGCAAACATGGCGAGCTCTTCCAATGTCGCTGTGAACTCTCTTGCTGGCCATGTCATCG[C/T]
AGAAAAATTGAAAAGGGGAACTATCTTGTCTACAAGGCACAAGTTGTCCCTCCCGTCCATGGTGCTCGGCTGGAAGGATACCTGACCAACGCAAGCAAGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.70%	7.20%	0.08%	0.00%	NA
All Indica	2759	97.90%	2.10%	0.04%	0.00%	NA
All Japonica	1512	93.60%	6.40%	0.00%	0.00%	NA
Aus	269	68.00%	31.60%	0.37%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	96.80%	3.20%	0.00%	0.00%	NA
Indica Intermediate	786	96.60%	3.30%	0.13%	0.00%	NA
Temperate Japonica	767	97.80%	2.20%	0.00%	0.00%	NA
Tropical Japonica	504	93.80%	6.20%	0.00%	0.00%	NA
Japonica Intermediate	241	79.70%	20.30%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	92.70%	1.04%	0.00%	NA
Intermediate	90	85.60%	13.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0140883886	G -> A	LOC_Os01g70630.1	upstream_gene_variant ; 680.0bp to feature; MODIFIER	silent_mutation	Average:40.281; most accessible tissue: Zhenshan97 young leaf, score: 64.205	N	N	N	N
vg0140883886	G -> A	LOC_Os01g70600.1	downstream_gene_variant ; 2705.0bp to feature; MODIFIER	silent_mutation	Average:40.281; most accessible tissue: Zhenshan97 young leaf, score: 64.205	N	N	N	N
vg0140883886	G -> A	LOC_Os01g70610.1	downstream_gene_variant ; 1787.0bp to feature; MODIFIER	silent_mutation	Average:40.281; most accessible tissue: Zhenshan97 young leaf, score: 64.205	N	N	N	N
vg0140883886	G -> A	LOC_Os01g70620.1	downstream_gene_variant ; 483.0bp to feature; MODIFIER	silent_mutation	Average:40.281; most accessible tissue: Zhenshan97 young leaf, score: 64.205	N	N	N	N
vg0140883886	G -> A	LOC_Os01g70620-LOC_Os01g70630	intergenic_region ; MODIFIER	silent_mutation	Average:40.281; most accessible tissue: Zhenshan97 young leaf, score: 64.205	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0140883886	2.41E-06	NA	mr1117	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	1.22E-06	NA	mr1496	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	NA	1.93E-08	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	4.15E-07	NA	mr1113_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	4.17E-08	NA	mr1114_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	3.28E-08	NA	mr1117_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	5.87E-06	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	1.06E-07	NA	mr1119_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	1.12E-07	NA	mr1120_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	4.44E-06	NA	mr1123_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	1.84E-06	NA	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	1.15E-06	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	4.00E-07	NA	mr1247_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	1.71E-06	NA	mr1495_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	NA	2.37E-08	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	NA	3.28E-07	mr1808_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140883886	9.40E-08	NA	mr1961_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251