\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140863872:

Variant ID: vg0140863872 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 40863872
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.00, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTCTTGCACACCGCGCTGCGCGGGCTCTTCATCGTCTTCACGATCGCCAGCATCACCTTGCCACTGCTCGATTAGCCACAAAACCAAATCAAATCAAA[T/C]
TGAAAATCCCACCAACACTTCTCCTGCTCAAAATCAAGAGCAGTGAATTGTGGATGAACTGGAGCGCGTACAGGATGGGGTTGAGGAGGGAGGGGTGGTG

Reverse complement sequence

CACCACCCCTCCCTCCTCAACCCCATCCTGTACGCGCTCCAGTTCATCCACAATTCACTGCTCTTGATTTTGAGCAGGAGAAGTGTTGGTGGGATTTTCA[A/G]
TTTGATTTGATTTGGTTTTGTGGCTAATCGAGCAGTGGCAAGGTGATGCTGGCGATCGTGAAGACGATGAAGAGCCCGCGCAGCGCGGTGTGCAAGACCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.80% 5.20% 0.00% 0.00% NA
All Indica  2759 98.10% 1.90% 0.00% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 67.70% 32.30% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 96.70% 3.30% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 7.30% 92.70% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140863872 T -> C LOC_Os01g70550.1 upstream_gene_variant ; 1951.0bp to feature; MODIFIER silent_mutation Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 N N N N
vg0140863872 T -> C LOC_Os01g70550.3 upstream_gene_variant ; 2801.0bp to feature; MODIFIER silent_mutation Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 N N N N
vg0140863872 T -> C LOC_Os01g70550.2 upstream_gene_variant ; 1951.0bp to feature; MODIFIER silent_mutation Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 N N N N
vg0140863872 T -> C LOC_Os01g70570.1 downstream_gene_variant ; 1036.0bp to feature; MODIFIER silent_mutation Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 N N N N
vg0140863872 T -> C LOC_Os01g70580.1 downstream_gene_variant ; 4836.0bp to feature; MODIFIER silent_mutation Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 N N N N
vg0140863872 T -> C LOC_Os01g70570.2 downstream_gene_variant ; 1036.0bp to feature; MODIFIER silent_mutation Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 N N N N
vg0140863872 T -> C LOC_Os01g70570.3 downstream_gene_variant ; 2637.0bp to feature; MODIFIER silent_mutation Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 N N N N
vg0140863872 T -> C LOC_Os01g70560.1 intron_variant ; MODIFIER silent_mutation Average:77.42; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140863872 NA 1.30E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140863872 5.63E-08 NA mr1134_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140863872 NA 2.20E-09 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251