Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140856534:

Variant ID: vg0140856534 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 40856534
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GCGATCGTGCGCTACAAGGCGCGCCTCGTCGCTAAGGGGTACGTCCAGCGACAGGGGGTGGACTTCGACGAGGTCTTCGCACCTGTCGCCCGGCTGGAAT[C/T]
GGTGCGCCTCCTTCTCGTCGTCGCCGTGCACCAAGGGTGGCAAGTCCACCACATGGACGTCAAGTCGGCATTCCTCAACGGCGAGCTGCTCGAGGAAGTT

Reverse complement sequence

AACTTCCTCGAGCAGCTCGCCGTTGAGGAATGCCGACTTGACGTCCATGTGGTGGACTTGCCACCCTTGGTGCACGGCGACGACGAGAAGGAGGCGCACC[G/A]
ATTCCAGCCGGGCGACAGGTGCGAAGACCTCGTCGAAGTCCACCCCCTGTCGCTGGACGTACCCCTTAGCGACGAGGCGCGCCTTGTAGCGCACGATCGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.50%	19.10%	1.78%	20.65%	NA
All Indica	2759	47.40%	29.00%	2.32%	21.24%	NA
All Japonica	1512	90.10%	0.20%	0.20%	9.46%	NA
Aus	269	10.00%	31.60%	4.46%	53.90%	NA
Indica I	595	13.30%	43.40%	4.54%	38.82%	NA
Indica II	465	47.10%	12.70%	2.15%	38.06%	NA
Indica III	913	72.60%	25.80%	0.00%	1.53%	NA
Indica Intermediate	786	44.10%	31.60%	3.44%	20.87%	NA
Temperate Japonica	767	98.40%	0.10%	0.13%	1.30%	NA
Tropical Japonica	504	78.80%	0.40%	0.40%	20.44%	NA
Japonica Intermediate	241	87.60%	0.00%	0.00%	12.45%	NA
VI/Aromatic	96	12.50%	5.20%	2.08%	80.21%	NA
Intermediate	90	60.00%	8.90%	3.33%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0140856534	C -> T	LOC_Os01g70540.1	missense_variant ; p.Ser1168Leu; MODERATE	nonsynonymous_codon ; S1168L	Average:13.599; most accessible tissue: Minghui63 young leaf, score: 26.082	benign	0.766	DELETERIOUS	0.00
vg0140856534	C -> DEL	LOC_Os01g70540.1	N	frameshift_variant	Average:13.599; most accessible tissue: Minghui63 young leaf, score: 26.082	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0140856534	NA	1.14E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	5.19E-06	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	1.68E-06	mr1217	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	5.40E-08	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	6.46E-06	mr1367	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	9.28E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	1.14E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	4.26E-06	mr1511	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	9.46E-11	mr1607	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	5.57E-08	mr1607	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	4.10E-06	mr1681	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	2.25E-07	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	2.03E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140856534	NA	8.73E-07	mr1943	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251