Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140812330:

Variant ID: vg0140812330 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 40812330
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAACCAGCTGCAAATATATTTTAAGGAGATAAATAAAGAGAGATAAGAGCAGCTAGCTATAGATTTGTAGCCAGCTGTAGCACAGAATCTAAGACACA[A/G]
TGTGTGTATAACAAGTGAGACTAGGTATTAATAGTATAGTATGTAACTATTGTATAAATAAGTTATTAGATTGACTACAGATGAATTGAAGCCAAATAAT

Reverse complement sequence

ATTATTTGGCTTCAATTCATCTGTAGTCAATCTAATAACTTATTTATACAATAGTTACATACTATACTATTAATACCTAGTCTCACTTGTTATACACACA[T/C]
TGTGTCTTAGATTCTGTGCTACAGCTGGCTACAAATCTATAGCTAGCTGCTCTTATCTCTCTTTATTTATCTCCTTAAAATATATTTGCAGCTGGTTTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.40% 38.30% 0.25% 0.00% NA
All Indica  2759 91.30% 8.60% 0.18% 0.00% NA
All Japonica  1512 8.70% 91.10% 0.20% 0.00% NA
Aus  269 76.60% 23.00% 0.37% 0.00% NA
Indica I  595 97.00% 2.70% 0.34% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 84.60% 15.40% 0.00% 0.00% NA
Indica Intermediate  786 90.50% 9.30% 0.25% 0.00% NA
Temperate Japonica  767 14.00% 85.70% 0.39% 0.00% NA
Tropical Japonica  504 2.40% 97.60% 0.00% 0.00% NA
Japonica Intermediate  241 5.40% 94.60% 0.00% 0.00% NA
VI/Aromatic  96 4.20% 95.80% 0.00% 0.00% NA
Intermediate  90 48.90% 47.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140812330 A -> G LOC_Os01g70470.1 upstream_gene_variant ; 213.0bp to feature; MODIFIER silent_mutation Average:98.297; most accessible tissue: Minghui63 young leaf, score: 99.738 N N N N
vg0140812330 A -> G LOC_Os01g70460.1 downstream_gene_variant ; 2950.0bp to feature; MODIFIER silent_mutation Average:98.297; most accessible tissue: Minghui63 young leaf, score: 99.738 N N N N
vg0140812330 A -> G LOC_Os01g70460.2 downstream_gene_variant ; 3830.0bp to feature; MODIFIER silent_mutation Average:98.297; most accessible tissue: Minghui63 young leaf, score: 99.738 N N N N
vg0140812330 A -> G LOC_Os01g70460.3 downstream_gene_variant ; 2950.0bp to feature; MODIFIER silent_mutation Average:98.297; most accessible tissue: Minghui63 young leaf, score: 99.738 N N N N
vg0140812330 A -> G LOC_Os01g70460-LOC_Os01g70470 intergenic_region ; MODIFIER silent_mutation Average:98.297; most accessible tissue: Minghui63 young leaf, score: 99.738 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0140812330 A G 0.05 0.01 -0.02 0.0 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140812330 NA 4.47E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 5.16E-06 NA mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 1.76E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 3.20E-14 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 1.13E-06 mr1315 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 2.34E-06 mr1392 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 2.38E-06 NA mr1504 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 2.62E-08 mr1506 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 2.36E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 2.26E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 1.10E-10 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 9.49E-29 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 2.22E-12 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 5.47E-11 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 7.96E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 7.96E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140812330 NA 4.65E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251