\
| Variant ID: vg0140789733 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 40789733 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )
ACAAATTATTGGCTTCAGCATTGTATAAAAATAGAGATCCTCTTCTACTAAATTAAGGAAATACTAGTATGAATGAGCTGCACGTCTCTCTTGGACAGTT[A/G]
GGTCATGAGCCATTTCAAGCTGTAGGCATAGGAGTTGGCTTCATTATGTGTAAGAAGCAAGTTATAAAAATCTACCATTTTTTTTTATTCAACAATGTGG
CCACATTGTTGAATAAAAAAAAATGGTAGATTTTTATAACTTGCTTCTTACACATAATGAAGCCAACTCCTATGCCTACAGCTTGAAATGGCTCATGACC[T/C]
AACTGTCCAAGAGAGACGTGCAGCTCATTCATACTAGTATTTCCTTAATTTAGTAGAAGAGGATCTCTATTTTTATACAATGCTGAAGCCAATAATTTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.00% | 29.70% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 9.90% | 89.10% | 1.06% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 14.00% | 84.00% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 4.60% | 95.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.90% | 92.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 33.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0140789733 | A -> G | LOC_Os01g70390.1 | downstream_gene_variant ; 4848.0bp to feature; MODIFIER | silent_mutation | Average:50.063; most accessible tissue: Callus, score: 81.954 | N | N | N | N |
| vg0140789733 | A -> G | LOC_Os01g70400.1 | downstream_gene_variant ; 2513.0bp to feature; MODIFIER | silent_mutation | Average:50.063; most accessible tissue: Callus, score: 81.954 | N | N | N | N |
| vg0140789733 | A -> G | LOC_Os01g70430.1 | downstream_gene_variant ; 4391.0bp to feature; MODIFIER | silent_mutation | Average:50.063; most accessible tissue: Callus, score: 81.954 | N | N | N | N |
| vg0140789733 | A -> G | LOC_Os01g70410.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.063; most accessible tissue: Callus, score: 81.954 | N | N | N | N |
| vg0140789733 | A -> G | LOC_Os01g70410.2 | intron_variant ; MODIFIER | silent_mutation | Average:50.063; most accessible tissue: Callus, score: 81.954 | N | N | N | N |
| vg0140789733 | A -> G | LOC_Os01g70410.3 | intron_variant ; MODIFIER | silent_mutation | Average:50.063; most accessible tissue: Callus, score: 81.954 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0140789733 | NA | 1.17E-22 | mr1122 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 6.95E-23 | mr1168 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 4.48E-11 | mr1172 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.79E-45 | mr1194 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 5.83E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.53E-26 | mr1223 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 2.32E-26 | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 8.18E-48 | mr1480 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 5.86E-14 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.15E-15 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 2.20E-16 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 7.27E-12 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 5.82E-58 | mr1692 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.07E-59 | mr1711 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 9.87E-19 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.65E-27 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 4.75E-26 | mr1731 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.63E-11 | mr1751 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 3.75E-19 | mr1767 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.74E-23 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 3.77E-25 | mr1839 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.89E-15 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 2.03E-11 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 2.15E-33 | mr1932 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.36E-18 | mr1968 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 3.51E-30 | mr1102_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.13E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 8.12E-21 | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 2.81E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.21E-53 | mr1480_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 5.37E-14 | mr1529_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 4.36E-14 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 4.20E-14 | mr1641_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 4.61E-25 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 7.18E-19 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 2.07E-09 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 2.94E-16 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 6.06E-18 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 7.33E-15 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 6.58E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.58E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140789733 | NA | 1.46E-23 | mr1968_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |