Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0140754215:

Variant ID: vg0140754215 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 40754215
Reference Allele: T	Alternative Allele: A,TA
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCAACAATTCTCATATTGTTGCATTACCTCCATGATTTTCCTTGATAACTTGATAGTTCATTCCATCAATCTCATCATGGTCAGTACGGGTGTTTTTTTT[T/A,TA]
AAAAAAAAACTTGACTAATTCTGGCTTAACTTCCAAGCTTTTTACATGTAACAATATTATATAGTTGCATGAAGTTGAGCTTATTAGTATAAGCATCTTC

Reverse complement sequence

GAAGATGCTTATACTAATAAGCTCAACTTCATGCAACTATATAATATTGTTACATGTAAAAAGCTTGGAAGTTAAGCCAGAATTAGTCAAGTTTTTTTTT[A/T,TA]
AAAAAAAACACCCGTACTGACCATGATGAGATTGATGGAATGAACTATCAAGTTATCAAGGAAAATCATGGAGGTAATGCAACAATATGAGAATTGTTGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.90%	15.70%	1.99%	0.00%	TA: 0.36%
All Indica	2759	99.20%	0.60%	0.11%	0.00%	TA: 0.07%
All Japonica	1512	48.30%	46.10%	5.09%	0.00%	TA: 0.53%
Aus	269	98.50%	1.10%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	98.60%	1.20%	0.11%	0.00%	TA: 0.11%
Indica Intermediate	786	99.10%	0.50%	0.25%	0.00%	TA: 0.13%
Temperate Japonica	767	73.50%	21.40%	4.95%	0.00%	TA: 0.13%
Tropical Japonica	504	14.70%	78.00%	6.15%	0.00%	TA: 1.19%
Japonica Intermediate	241	38.20%	58.10%	3.32%	0.00%	TA: 0.41%
VI/Aromatic	96	78.10%	7.30%	8.33%	0.00%	TA: 6.25%
Intermediate	90	71.10%	22.20%	5.56%	0.00%	TA: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0140754215	T -> TA	LOC_Os01g70340.1	upstream_gene_variant ; 3394.0bp to feature; MODIFIER	silent_mutation	Average:30.287; most accessible tissue: Callus, score: 68.659	N	N	N	N
vg0140754215	T -> TA	LOC_Os01g70350.1	downstream_gene_variant ; 1538.0bp to feature; MODIFIER	silent_mutation	Average:30.287; most accessible tissue: Callus, score: 68.659	N	N	N	N
vg0140754215	T -> TA	LOC_Os01g70340-LOC_Os01g70350	intergenic_region ; MODIFIER	silent_mutation	Average:30.287; most accessible tissue: Callus, score: 68.659	N	N	N	N
vg0140754215	T -> A	LOC_Os01g70340.1	upstream_gene_variant ; 3393.0bp to feature; MODIFIER	silent_mutation	Average:30.287; most accessible tissue: Callus, score: 68.659	N	N	N	N
vg0140754215	T -> A	LOC_Os01g70350.1	downstream_gene_variant ; 1539.0bp to feature; MODIFIER	silent_mutation	Average:30.287; most accessible tissue: Callus, score: 68.659	N	N	N	N
vg0140754215	T -> A	LOC_Os01g70340-LOC_Os01g70350	intergenic_region ; MODIFIER	silent_mutation	Average:30.287; most accessible tissue: Callus, score: 68.659	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0140754215	9.62E-06	NA	mr1679	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140754215	3.43E-06	NA	mr1720	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140754215	NA	2.78E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251