| Variant ID: vg0140754215 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 40754215 |
| Reference Allele: T | Alternative Allele: A,TA |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCAACAATTCTCATATTGTTGCATTACCTCCATGATTTTCCTTGATAACTTGATAGTTCATTCCATCAATCTCATCATGGTCAGTACGGGTGTTTTTTTT[T/A,TA]
AAAAAAAAACTTGACTAATTCTGGCTTAACTTCCAAGCTTTTTACATGTAACAATATTATATAGTTGCATGAAGTTGAGCTTATTAGTATAAGCATCTTC
GAAGATGCTTATACTAATAAGCTCAACTTCATGCAACTATATAATATTGTTACATGTAAAAAGCTTGGAAGTTAAGCCAGAATTAGTCAAGTTTTTTTTT[A/T,TA]
AAAAAAAACACCCGTACTGACCATGATGAGATTGATGGAATGAACTATCAAGTTATCAAGGAAAATCATGGAGGTAATGCAACAATATGAGAATTGTTGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.90% | 15.70% | 1.99% | 0.00% | TA: 0.36% |
| All Indica | 2759 | 99.20% | 0.60% | 0.11% | 0.00% | TA: 0.07% |
| All Japonica | 1512 | 48.30% | 46.10% | 5.09% | 0.00% | TA: 0.53% |
| Aus | 269 | 98.50% | 1.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.20% | 0.11% | 0.00% | TA: 0.11% |
| Indica Intermediate | 786 | 99.10% | 0.50% | 0.25% | 0.00% | TA: 0.13% |
| Temperate Japonica | 767 | 73.50% | 21.40% | 4.95% | 0.00% | TA: 0.13% |
| Tropical Japonica | 504 | 14.70% | 78.00% | 6.15% | 0.00% | TA: 1.19% |
| Japonica Intermediate | 241 | 38.20% | 58.10% | 3.32% | 0.00% | TA: 0.41% |
| VI/Aromatic | 96 | 78.10% | 7.30% | 8.33% | 0.00% | TA: 6.25% |
| Intermediate | 90 | 71.10% | 22.20% | 5.56% | 0.00% | TA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0140754215 | T -> TA | LOC_Os01g70340.1 | upstream_gene_variant ; 3394.0bp to feature; MODIFIER | silent_mutation | Average:30.287; most accessible tissue: Callus, score: 68.659 | N | N | N | N |
| vg0140754215 | T -> TA | LOC_Os01g70350.1 | downstream_gene_variant ; 1538.0bp to feature; MODIFIER | silent_mutation | Average:30.287; most accessible tissue: Callus, score: 68.659 | N | N | N | N |
| vg0140754215 | T -> TA | LOC_Os01g70340-LOC_Os01g70350 | intergenic_region ; MODIFIER | silent_mutation | Average:30.287; most accessible tissue: Callus, score: 68.659 | N | N | N | N |
| vg0140754215 | T -> A | LOC_Os01g70340.1 | upstream_gene_variant ; 3393.0bp to feature; MODIFIER | silent_mutation | Average:30.287; most accessible tissue: Callus, score: 68.659 | N | N | N | N |
| vg0140754215 | T -> A | LOC_Os01g70350.1 | downstream_gene_variant ; 1539.0bp to feature; MODIFIER | silent_mutation | Average:30.287; most accessible tissue: Callus, score: 68.659 | N | N | N | N |
| vg0140754215 | T -> A | LOC_Os01g70340-LOC_Os01g70350 | intergenic_region ; MODIFIER | silent_mutation | Average:30.287; most accessible tissue: Callus, score: 68.659 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0140754215 | 9.62E-06 | NA | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140754215 | 3.43E-06 | NA | mr1720 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140754215 | NA | 2.78E-07 | mr1180_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |