\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140721750:

Variant ID: vg0140721750 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 40721750
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


CCTAATTTCGTGCATAATTGCACGTGAAAATCCATTATTAGTTCGTGAGAAAACAACGGCTCCCATCGGATGGCCTATTCAGCCAAAGAAAAAGCCAAAA[T/C]
TTGAATTTTCAAACTTAATTTTGATATTGATTTTGAGATATTTTCAACGTATTTTCTTTTTCAGCATTGGCTTTTAAGTCACCGAGAACACATATATGAA

Reverse complement sequence

TTCATATATGTGTTCTCGGTGACTTAAAAGCCAATGCTGAAAAAGAAAATACGTTGAAAATATCTCAAAATCAATATCAAAATTAAGTTTGAAAATTCAA[A/G]
TTTTGGCTTTTTCTTTGGCTGAATAGGCCATCCGATGGGAGCCGTTGTTTTCTCACGAACTAATAATGGATTTTCACGTGCAATTATGCACGAAATTAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.10% 10.80% 2.54% 53.55% NA
All Indica  2759 1.90% 11.00% 3.52% 83.54% NA
All Japonica  1512 96.80% 1.50% 0.13% 1.65% NA
Aus  269 0.70% 29.70% 6.69% 62.83% NA
Indica I  595 2.70% 10.40% 9.24% 77.65% NA
Indica II  465 2.20% 1.10% 0.43% 96.34% NA
Indica III  913 0.50% 13.90% 1.97% 83.57% NA
Indica Intermediate  786 2.80% 14.00% 2.80% 80.41% NA
Temperate Japonica  767 98.40% 0.10% 0.26% 1.17% NA
Tropical Japonica  504 95.40% 2.40% 0.00% 2.18% NA
Japonica Intermediate  241 94.20% 3.70% 0.00% 2.07% NA
VI/Aromatic  96 3.10% 94.80% 0.00% 2.08% NA
Intermediate  90 50.00% 13.30% 3.33% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140721750 T -> DEL N N silent_mutation Average:41.667; most accessible tissue: Callus, score: 77.081 N N N N
vg0140721750 T -> C LOC_Os01g70310.1 upstream_gene_variant ; 4571.0bp to feature; MODIFIER silent_mutation Average:41.667; most accessible tissue: Callus, score: 77.081 N N N N
vg0140721750 T -> C LOC_Os01g70310.2 upstream_gene_variant ; 4571.0bp to feature; MODIFIER silent_mutation Average:41.667; most accessible tissue: Callus, score: 77.081 N N N N
vg0140721750 T -> C LOC_Os01g70320.1 downstream_gene_variant ; 1635.0bp to feature; MODIFIER silent_mutation Average:41.667; most accessible tissue: Callus, score: 77.081 N N N N
vg0140721750 T -> C LOC_Os01g70310-LOC_Os01g70320 intergenic_region ; MODIFIER silent_mutation Average:41.667; most accessible tissue: Callus, score: 77.081 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140721750 NA 5.18E-08 mr1686 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251