\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140492713:

Variant ID: vg0140492713 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 40492713
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTCCTCATATAGAGCAACAGAGGAGGGCGGGTTCAGGTGTCGGTGCTCCAGCGAGAGAATGACAGTAACTGCAGTGATAGGACGCGTTCTACCGCTTTA[G/A]
TAATGGTAGGATGGGTCAAGGGGAGGAGCTCGAGCTACACACATCGCTCTGGCGCTCGACCTCTCCCGCGTGGTCGATAACTTCACCTTCCGTTCCATTC

Reverse complement sequence

GAATGGAACGGAAGGTGAAGTTATCGACCACGCGGGAGAGGTCGAGCGCCAGAGCGATGTGTGTAGCTCGAGCTCCTCCCCTTGACCCATCCTACCATTA[C/T]
TAAAGCGGTAGAACGCGTCCTATCACTGCAGTTACTGTCATTCTCTCGCTGGAGCACCGACACCTGAACCCGCCCTCCTCTGTTGCTCTATATGAGGAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.70% 12.50% 1.27% 51.57% NA
All Indica  2759 23.70% 0.40% 1.59% 74.34% NA
All Japonica  1512 60.50% 37.20% 0.07% 2.18% NA
Aus  269 8.60% 0.40% 3.72% 87.36% NA
Indica I  595 32.30% 0.20% 1.01% 66.55% NA
Indica II  465 11.60% 0.40% 1.29% 86.67% NA
Indica III  913 18.70% 0.70% 2.08% 78.53% NA
Indica Intermediate  786 30.20% 0.10% 1.65% 68.07% NA
Temperate Japonica  767 93.00% 6.60% 0.13% 0.26% NA
Tropical Japonica  504 19.20% 76.80% 0.00% 3.97% NA
Japonica Intermediate  241 43.60% 51.90% 0.00% 4.56% NA
VI/Aromatic  96 9.40% 0.00% 4.17% 86.46% NA
Intermediate  90 41.10% 18.90% 1.11% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140492713 G -> A LOC_Os01g69990.1 upstream_gene_variant ; 3053.0bp to feature; MODIFIER silent_mutation Average:13.366; most accessible tissue: Callus, score: 83.854 N N N N
vg0140492713 G -> A LOC_Os01g70000.1 upstream_gene_variant ; 981.0bp to feature; MODIFIER silent_mutation Average:13.366; most accessible tissue: Callus, score: 83.854 N N N N
vg0140492713 G -> A LOC_Os01g70010.1 downstream_gene_variant ; 3630.0bp to feature; MODIFIER silent_mutation Average:13.366; most accessible tissue: Callus, score: 83.854 N N N N
vg0140492713 G -> A LOC_Os01g69990-LOC_Os01g70000 intergenic_region ; MODIFIER silent_mutation Average:13.366; most accessible tissue: Callus, score: 83.854 N N N N
vg0140492713 G -> DEL N N silent_mutation Average:13.366; most accessible tissue: Callus, score: 83.854 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140492713 NA 1.22E-22 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 2.89E-08 mr1189_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 5.62E-13 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 6.37E-09 mr1338_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 9.51E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 7.39E-21 mr1383_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 6.81E-09 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 9.17E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 1.09E-06 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 4.72E-09 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 3.66E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 3.39E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 3.70E-09 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 5.30E-12 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 9.13E-10 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 9.30E-06 mr1621_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 4.66E-12 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 5.17E-06 mr1722_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 1.24E-17 mr1742_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 7.40E-09 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 4.56E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 1.25E-07 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 9.44E-10 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 1.07E-12 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 1.15E-23 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713 NA 1.50E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251