Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140492713:

Variant ID: vg0140492713 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 40492713
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTCCTCATATAGAGCAACAGAGGAGGGCGGGTTCAGGTGTCGGTGCTCCAGCGAGAGAATGACAGTAACTGCAGTGATAGGACGCGTTCTACCGCTTTA[G/A]
TAATGGTAGGATGGGTCAAGGGGAGGAGCTCGAGCTACACACATCGCTCTGGCGCTCGACCTCTCCCGCGTGGTCGATAACTTCACCTTCCGTTCCATTC

Reverse complement sequence

GAATGGAACGGAAGGTGAAGTTATCGACCACGCGGGAGAGGTCGAGCGCCAGAGCGATGTGTGTAGCTCGAGCTCCTCCCCTTGACCCATCCTACCATTA[C/T]
TAAAGCGGTAGAACGCGTCCTATCACTGCAGTTACTGTCATTCTCTCGCTGGAGCACCGACACCTGAACCCGCCCTCCTCTGTTGCTCTATATGAGGAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.70%	12.50%	1.27%	51.57%	NA
All Indica	2759	23.70%	0.40%	1.59%	74.34%	NA
All Japonica	1512	60.50%	37.20%	0.07%	2.18%	NA
Aus	269	8.60%	0.40%	3.72%	87.36%	NA
Indica I	595	32.30%	0.20%	1.01%	66.55%	NA
Indica II	465	11.60%	0.40%	1.29%	86.67%	NA
Indica III	913	18.70%	0.70%	2.08%	78.53%	NA
Indica Intermediate	786	30.20%	0.10%	1.65%	68.07%	NA
Temperate Japonica	767	93.00%	6.60%	0.13%	0.26%	NA
Tropical Japonica	504	19.20%	76.80%	0.00%	3.97%	NA
Japonica Intermediate	241	43.60%	51.90%	0.00%	4.56%	NA
VI/Aromatic	96	9.40%	0.00%	4.17%	86.46%	NA
Intermediate	90	41.10%	18.90%	1.11%	38.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0140492713	G -> A	LOC_Os01g69990.1	upstream_gene_variant ; 3053.0bp to feature; MODIFIER	silent_mutation	Average:13.366; most accessible tissue: Callus, score: 83.854	N	N	N	N
vg0140492713	G -> A	LOC_Os01g70000.1	upstream_gene_variant ; 981.0bp to feature; MODIFIER	silent_mutation	Average:13.366; most accessible tissue: Callus, score: 83.854	N	N	N	N
vg0140492713	G -> A	LOC_Os01g70010.1	downstream_gene_variant ; 3630.0bp to feature; MODIFIER	silent_mutation	Average:13.366; most accessible tissue: Callus, score: 83.854	N	N	N	N
vg0140492713	G -> A	LOC_Os01g69990-LOC_Os01g70000	intergenic_region ; MODIFIER	silent_mutation	Average:13.366; most accessible tissue: Callus, score: 83.854	N	N	N	N
vg0140492713	G -> DEL	N	N	silent_mutation	Average:13.366; most accessible tissue: Callus, score: 83.854	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0140492713	NA	1.22E-22	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	2.89E-08	mr1189_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	5.62E-13	mr1338_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	6.37E-09	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	9.51E-07	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	7.39E-21	mr1383_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	6.81E-09	mr1383_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	9.17E-06	mr1405_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	1.09E-06	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	4.72E-09	mr1449_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	3.66E-06	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	3.39E-07	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	3.70E-09	mr1502_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	5.30E-12	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	9.13E-10	mr1543_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	9.30E-06	mr1621_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	4.66E-12	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	5.17E-06	mr1722_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	1.24E-17	mr1742_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	7.40E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	4.56E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	1.25E-07	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	9.44E-10	mr1851_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	1.07E-12	mr1864_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	1.15E-23	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140492713	NA	1.50E-06	mr1966_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251