\
| Variant ID: vg0140395579 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 40395579 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCTTTTAAGCCTAATTGTACCATGATTTGACAATATGGTGCTACAGTAAATATTTGCTAATGACGGATTAATTAGGCTTAATAAATCTGTCTCGCAGTTT[T/C]
CTGGTGGAATATGTAATTTGTTTTGTTATTAGACTACGTTTAATACTCCCTCCATCCACAAAAGTTACACCTATTTCACATTTGAGTTTTTCCAAATAAG
CTTATTTGGAAAAACTCAAATGTGAAATAGGTGTAACTTTTGTGGATGGAGGGAGTATTAAACGTAGTCTAATAACAAAACAAATTACATATTCCACCAG[A/G]
AAACTGCGAGACAGATTTATTAAGCCTAATTAATCCGTCATTAGCAAATATTTACTGTAGCACCATATTGTCAAATCATGGTACAATTAGGCTTAAAAGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.60% | 20.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 39.00% | 61.00% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 6.10% | 93.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 79.40% | 20.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 21.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0140395579 | T -> C | LOC_Os01g69910.1 | upstream_gene_variant ; 1736.0bp to feature; MODIFIER | silent_mutation | Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0140395579 | T -> C | LOC_Os01g69910.3 | upstream_gene_variant ; 1724.0bp to feature; MODIFIER | silent_mutation | Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0140395579 | T -> C | LOC_Os01g69910.2 | upstream_gene_variant ; 1736.0bp to feature; MODIFIER | silent_mutation | Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0140395579 | T -> C | LOC_Os01g69904.1 | downstream_gene_variant ; 2456.0bp to feature; MODIFIER | silent_mutation | Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| vg0140395579 | T -> C | LOC_Os01g69904-LOC_Os01g69910 | intergenic_region ; MODIFIER | silent_mutation | Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0140395579 | NA | 2.53E-06 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140395579 | NA | 1.48E-32 | mr1137_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140395579 | NA | 6.32E-57 | mr1235_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140395579 | NA | 5.91E-60 | mr1241_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140395579 | NA | 1.41E-26 | mr1617_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140395579 | NA | 3.57E-06 | mr1693_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140395579 | NA | 2.85E-12 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140395579 | NA | 1.03E-43 | mr1784_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140395579 | NA | 9.30E-06 | mr1840_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140395579 | NA | 8.13E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140395579 | NA | 7.86E-39 | mr1862_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |