\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140395579:

Variant ID: vg0140395579 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 40395579
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTTTAAGCCTAATTGTACCATGATTTGACAATATGGTGCTACAGTAAATATTTGCTAATGACGGATTAATTAGGCTTAATAAATCTGTCTCGCAGTTT[T/C]
CTGGTGGAATATGTAATTTGTTTTGTTATTAGACTACGTTTAATACTCCCTCCATCCACAAAAGTTACACCTATTTCACATTTGAGTTTTTCCAAATAAG

Reverse complement sequence

CTTATTTGGAAAAACTCAAATGTGAAATAGGTGTAACTTTTGTGGATGGAGGGAGTATTAAACGTAGTCTAATAACAAAACAAATTACATATTCCACCAG[A/G]
AAACTGCGAGACAGATTTATTAAGCCTAATTAATCCGTCATTAGCAAATATTTACTGTAGCACCATATTGTCAAATCATGGTACAATTAGGCTTAAAAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.60% 20.40% 0.02% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 39.00% 61.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.30% 1.70% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 6.10% 93.70% 0.13% 0.00% NA
Tropical Japonica  504 79.40% 20.60% 0.00% 0.00% NA
Japonica Intermediate  241 58.90% 41.10% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0140395579 T -> C LOC_Os01g69910.1 upstream_gene_variant ; 1736.0bp to feature; MODIFIER silent_mutation Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0140395579 T -> C LOC_Os01g69910.3 upstream_gene_variant ; 1724.0bp to feature; MODIFIER silent_mutation Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0140395579 T -> C LOC_Os01g69910.2 upstream_gene_variant ; 1736.0bp to feature; MODIFIER silent_mutation Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0140395579 T -> C LOC_Os01g69904.1 downstream_gene_variant ; 2456.0bp to feature; MODIFIER silent_mutation Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N
vg0140395579 T -> C LOC_Os01g69904-LOC_Os01g69910 intergenic_region ; MODIFIER silent_mutation Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0140395579 NA 2.53E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579 NA 1.48E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579 NA 6.32E-57 mr1235_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579 NA 5.91E-60 mr1241_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579 NA 1.41E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579 NA 3.57E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579 NA 2.85E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579 NA 1.03E-43 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579 NA 9.30E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579 NA 8.13E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579 NA 7.86E-39 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251