Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0140395579:

Variant ID: vg0140395579 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 40395579
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTTTAAGCCTAATTGTACCATGATTTGACAATATGGTGCTACAGTAAATATTTGCTAATGACGGATTAATTAGGCTTAATAAATCTGTCTCGCAGTTT[T/C]
CTGGTGGAATATGTAATTTGTTTTGTTATTAGACTACGTTTAATACTCCCTCCATCCACAAAAGTTACACCTATTTCACATTTGAGTTTTTCCAAATAAG

Reverse complement sequence

CTTATTTGGAAAAACTCAAATGTGAAATAGGTGTAACTTTTGTGGATGGAGGGAGTATTAAACGTAGTCTAATAACAAAACAAATTACATATTCCACCAG[A/G]
AAACTGCGAGACAGATTTATTAAGCCTAATTAATCCGTCATTAGCAAATATTTACTGTAGCACCATATTGTCAAATCATGGTACAATTAGGCTTAAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.60%	20.40%	0.02%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.00%	0.00%	NA
All Japonica	1512	39.00%	61.00%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.30%	1.70%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.60%	0.00%	0.00%	NA
Temperate Japonica	767	6.10%	93.70%	0.13%	0.00%	NA
Tropical Japonica	504	79.40%	20.60%	0.00%	0.00%	NA
Japonica Intermediate	241	58.90%	41.10%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	78.90%	21.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0140395579	T -> C	LOC_Os01g69910.1	upstream_gene_variant ; 1736.0bp to feature; MODIFIER	silent_mutation	Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0140395579	T -> C	LOC_Os01g69910.3	upstream_gene_variant ; 1724.0bp to feature; MODIFIER	silent_mutation	Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0140395579	T -> C	LOC_Os01g69910.2	upstream_gene_variant ; 1736.0bp to feature; MODIFIER	silent_mutation	Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0140395579	T -> C	LOC_Os01g69904.1	downstream_gene_variant ; 2456.0bp to feature; MODIFIER	silent_mutation	Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N
vg0140395579	T -> C	LOC_Os01g69904-LOC_Os01g69910	intergenic_region ; MODIFIER	silent_mutation	Average:50.754; most accessible tissue: Zhenshan97 flag leaf, score: 69.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0140395579	NA	2.53E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579	NA	1.48E-32	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579	NA	6.32E-57	mr1235_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579	NA	5.91E-60	mr1241_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579	NA	1.41E-26	mr1617_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579	NA	3.57E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579	NA	2.85E-12	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579	NA	1.03E-43	mr1784_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579	NA	9.30E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579	NA	8.13E-11	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0140395579	NA	7.86E-39	mr1862_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251