\
| Variant ID: vg0140082114 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 40082114 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.52, T: 0.48, others allele: 0.00, population size: 85. )
CCTGGTCGCCGCTCAGCTAGGGTTCGAGCAAAGGAGAGAGAATGGAGGTCTGGCTAGCTGCGCTCCCCTCCATTAACCCCGTCTATTAACTCCCCAACGG[T/C]
GGACTGATCAGTGGGTCCCACAGCGCGACACGTCAGCAAAACCGGGCAAAAACTGAGTCAATACTGCCGAGGGACCTTGATGTGACCATGGCTACTACGG
CCGTAGTAGCCATGGTCACATCAAGGTCCCTCGGCAGTATTGACTCAGTTTTTGCCCGGTTTTGCTGACGTGTCGCGCTGTGGGACCCACTGATCAGTCC[A/G]
CCGTTGGGGAGTTAATAGACGGGGTTAATGGAGGGGAGCGCAGCTAGCCAGACCTCCATTCTCTCTCCTTTGCTCGAACCCTAGCTGAGCGGCGACCAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.30% | 38.60% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 91.80% | 8.10% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.50% | 3.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.40% | 7.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 83.50% | 16.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.30% | 98.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.20% | 97.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 52.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0140082114 | T -> C | LOC_Os01g69000.1 | upstream_gene_variant ; 2280.0bp to feature; MODIFIER | silent_mutation | Average:51.12; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| vg0140082114 | T -> C | LOC_Os01g68990.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.12; most accessible tissue: Minghui63 flag leaf, score: 71.116 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0140082114 | NA | 2.24E-26 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 3.87E-06 | mr1086 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 4.24E-06 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 4.19E-22 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 3.98E-07 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 6.00E-08 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 6.75E-29 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 3.59E-08 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 7.49E-12 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 2.11E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 2.65E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 9.19E-06 | mr1795 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0140082114 | NA | 1.20E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |