Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139875180:

Variant ID: vg0139875180 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 39875180
Reference Allele: CACGTCCAATTTAAAA	Alternative Allele: TACGTCCAATTTAAAA,C
Primary Allele: TACGTCCAATTTAAAA	Secondary Allele: CACGTCCAATTTAAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTCGTTTGCAAATATGATGTTTGAACGATGGGGCTGTTTGTTTATGCTTATTCGATCCGCTTACTAACAATTTAAATTTGTAAATAAAACATTTATATA[CACGTCCAATTTAAAA/TACGTCCAATTTAAAA,C]
GTAAATGTTATAAAGCAATCTATAAAAAAACCATAAAATCAACTCCAAAATTAAAATTTAATTTTGGCTTCTAGGTATAAGCATAAACGAAACAATTGGA

Reverse complement sequence

TCCAATTGTTTCGTTTATGCTTATACCTAGAAGCCAAAATTAAATTTTAATTTTGGAGTTGATTTTATGGTTTTTTTATAGATTGCTTTATAACATTTAC[TTTTAAATTGGACGTG/TTTTAAATTGGACGTA,G]
TATATAAATGTTTTATTTACAAATTTAAATTGTTAGTAAGCGGATCGAATAAGCATAAACAAACAGCCCCATCGTTCAAACATCATATTTGCAAACGAAA

Allele Frequencies:

Populations	Population Size	Frequency of TACGTCCAATTTAAAA(primary allele)	Frequency of CACGTCCAATTTAAAA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.90%	42.80%	0.23%	0.04%	C: 0.02%
All Indica	2759	83.90%	15.80%	0.33%	0.00%	NA
All Japonica	1512	2.40%	97.40%	0.07%	0.07%	C: 0.07%
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.50%	4.00%	0.50%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	75.40%	24.20%	0.44%	0.00%	NA
Indica Intermediate	786	76.70%	23.00%	0.25%	0.00%	NA
Temperate Japonica	767	1.40%	98.40%	0.13%	0.00%	NA
Tropical Japonica	504	2.20%	97.60%	0.00%	0.00%	C: 0.20%
Japonica Intermediate	241	5.80%	93.80%	0.00%	0.41%	NA
VI/Aromatic	96	30.20%	69.80%	0.00%	0.00%	NA
Intermediate	90	46.70%	51.10%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0139875180	CACGTCCAATTTAAAA -> TACGTCCAATTTAAAA	LOC_Os01g68660.1	upstream_gene_variant ; 1278.0bp to feature; MODIFIER	silent_mutation	Average:69.81; most accessible tissue: Callus, score: 88.56	N	N	N	N
vg0139875180	CACGTCCAATTTAAAA -> TACGTCCAATTTAAAA	LOC_Os01g68670.1	upstream_gene_variant ; 3779.0bp to feature; MODIFIER	silent_mutation	Average:69.81; most accessible tissue: Callus, score: 88.56	N	N	N	N
vg0139875180	CACGTCCAATTTAAAA -> TACGTCCAATTTAAAA	LOC_Os01g68650-LOC_Os01g68660	intergenic_region ; MODIFIER	silent_mutation	Average:69.81; most accessible tissue: Callus, score: 88.56	N	N	N	N
vg0139875180	CACGTCCAATTTAAAA -> DEL	N	N	silent_mutation	Average:69.81; most accessible tissue: Callus, score: 88.56	N	N	N	N
vg0139875180	CACGTCCAATTTAAAA -> C	LOC_Os01g68660.1	upstream_gene_variant ; 1277.0bp to feature; MODIFIER	silent_mutation	Average:69.81; most accessible tissue: Callus, score: 88.56	N	N	N	N
vg0139875180	CACGTCCAATTTAAAA -> C	LOC_Os01g68670.1	upstream_gene_variant ; 3778.0bp to feature; MODIFIER	silent_mutation	Average:69.81; most accessible tissue: Callus, score: 88.56	N	N	N	N
vg0139875180	CACGTCCAATTTAAAA -> C	LOC_Os01g68650-LOC_Os01g68660	intergenic_region ; MODIFIER	silent_mutation	Average:69.81; most accessible tissue: Callus, score: 88.56	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0139875180	NA	2.35E-22	mr1155	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	3.66E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	9.00E-06	mr1166	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	1.36E-06	mr1212	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	3.93E-32	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	4.94E-09	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	4.20E-08	mr1244	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	2.98E-06	mr1426	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	4.56E-06	2.38E-06	mr1427	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	5.97E-06	5.96E-06	mr1777	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	1.45E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	3.63E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	2.07E-24	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	4.34E-09	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	9.02E-06	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	4.60E-36	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	1.73E-08	mr1212_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	9.77E-12	mr1216_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	2.71E-07	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139875180	NA	2.82E-07	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251