\
| Variant ID: vg0139856883 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 39856883 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TATGTACACCTCAGTCTTTAAGAAAAAGATAAATGCATATTCTGAATAGATATTCAGGTTTCATTGCTAGAATTGAGTATTTCGAGTAAAGTCCATTACC[G/A]
GTCCCTAAACTTGTACCGTTGTGTCATCCCGATCCCTAAACTCACAAATCAACCGTTTAGGTCCTCAAACTTGTTTGACTGTGTCATCCCGGTCACTCGT
ACGAGTGACCGGGATGACACAGTCAAACAAGTTTGAGGACCTAAACGGTTGATTTGTGAGTTTAGGGATCGGGATGACACAACGGTACAAGTTTAGGGAC[C/T]
GGTAATGGACTTTACTCGAAATACTCAATTCTAGCAATGAAACCTGAATATCTATTCAGAATATGCATTTATCTTTTTCTTAAAGACTGAGGTGTACATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 8.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 90.50% | 9.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 66.20% | 33.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.20% | 12.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.60% | 16.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0139856883 | G -> A | LOC_Os01g68630.1 | upstream_gene_variant ; 921.0bp to feature; MODIFIER | silent_mutation | Average:41.055; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0139856883 | G -> A | LOC_Os01g68620.1 | downstream_gene_variant ; 835.0bp to feature; MODIFIER | silent_mutation | Average:41.055; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| vg0139856883 | G -> A | LOC_Os01g68620-LOC_Os01g68630 | intergenic_region ; MODIFIER | silent_mutation | Average:41.055; most accessible tissue: Minghui63 panicle, score: 73.225 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0139856883 | NA | 8.73E-06 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139856883 | NA | 8.17E-08 | mr1027_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139856883 | NA | 2.35E-06 | mr1364_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139856883 | NA | 8.38E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139856883 | NA | 2.85E-08 | mr1469_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139856883 | NA | 5.29E-07 | mr1469_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139856883 | NA | 1.68E-06 | mr1539_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |