\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139847808:

Variant ID: vg0139847808 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39847808
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.07, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


GTTGACTGAAAAACTTCATAACTTCCTAGTTCTTATGCACACAAAAATCAAAAGCCCTTCTGGGTGGGAGTGGGACACATATACTAATTCTTTTATTCAG[T/C]
TGGTAATAGGATACTTGAAGTCTTGAGCTAAGAAATAGACTGAGCAACTATTTCAAACATGGCCAGCTCCTATAGTGTGACAGGTGATGTGTACAAGCCC

Reverse complement sequence

GGGCTTGTACACATCACCTGTCACACTATAGGAGCTGGCCATGTTTGAAATAGTTGCTCAGTCTATTTCTTAGCTCAAGACTTCAAGTATCCTATTACCA[A/G]
CTGAATAAAAGAATTAGTATATGTGTCCCACTCCCACCCAGAAGGGCTTTTGATTTTTGTGTGCATAAGAACTAGGAAGTTATGAAGTTTTTCAGTCAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.10% 48.60% 0.30% 0.00% NA
All Indica  2759 25.30% 74.30% 0.36% 0.00% NA
All Japonica  1512 98.00% 1.90% 0.07% 0.00% NA
Aus  269 34.20% 65.40% 0.37% 0.00% NA
Indica I  595 12.40% 87.60% 0.00% 0.00% NA
Indica II  465 3.20% 96.80% 0.00% 0.00% NA
Indica III  913 36.70% 62.90% 0.44% 0.00% NA
Indica Intermediate  786 34.90% 64.40% 0.76% 0.00% NA
Temperate Japonica  767 98.30% 1.60% 0.13% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 97.10% 2.90% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139847808 T -> C LOC_Os01g68620.1 upstream_gene_variant ; 4793.0bp to feature; MODIFIER silent_mutation Average:77.05; most accessible tissue: Callus, score: 89.944 N N N N
vg0139847808 T -> C LOC_Os01g68598.1 downstream_gene_variant ; 1023.0bp to feature; MODIFIER silent_mutation Average:77.05; most accessible tissue: Callus, score: 89.944 N N N N
vg0139847808 T -> C LOC_Os01g68610.1 downstream_gene_variant ; 1837.0bp to feature; MODIFIER silent_mutation Average:77.05; most accessible tissue: Callus, score: 89.944 N N N N
vg0139847808 T -> C LOC_Os01g68598.2 downstream_gene_variant ; 1023.0bp to feature; MODIFIER silent_mutation Average:77.05; most accessible tissue: Callus, score: 89.944 N N N N
vg0139847808 T -> C LOC_Os01g68598-LOC_Os01g68610 intergenic_region ; MODIFIER silent_mutation Average:77.05; most accessible tissue: Callus, score: 89.944 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0139847808 T C 0.07 -0.01 0.0 0.0 -0.02 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139847808 NA 7.54E-09 mr1068 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 5.71E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 5.77E-07 mr1096 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 5.38E-07 mr1111 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 1.32E-06 mr1121 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 6.91E-06 mr1131 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 4.80E-08 mr1144 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 1.95E-23 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 1.33E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 3.44E-34 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 8.61E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 3.04E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 8.39E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 7.81E-06 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 1.55E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 9.00E-07 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 3.65E-08 mr1027_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 1.18E-09 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 5.25E-07 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 1.88E-07 mr1111_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 1.30E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 7.34E-08 mr1144_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 2.34E-36 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 6.36E-08 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 4.12E-12 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 8.74E-06 mr1260_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 3.07E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 1.20E-13 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 1.23E-06 mr1580_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 7.28E-08 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 1.50E-06 mr1825_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 7.40E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139847808 NA 1.13E-11 mr1870_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251