\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139835584:

Variant ID: vg0139835584 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39835584
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, C: 0.42, others allele: 0.00, population size: 31. )

Flanking Sequence (100 bp) in Reference Genome:


TATTAAATATAGACTACTTACAAAACTAATTACATAAATAAAAGCTAATTCACGAGACAAATTTTTTAAGCCTAATTAATCTATAATTAGAGAATGTTTA[A/C]
TGTAGCATCACATAGGCTAATCATGGATTAATTAGGCTCATTAGATTCGTCTCGCAAATTAGTCCAAGATTATGGATAGGTTTTATTAATAGTCTATATT

Reverse complement sequence

AATATAGACTATTAATAAAACCTATCCATAATCTTGGACTAATTTGCGAGACGAATCTAATGAGCCTAATTAATCCATGATTAGCCTATGTGATGCTACA[T/G]
TAAACATTCTCTAATTATAGATTAATTAGGCTTAAAAAATTTGTCTCGTGAATTAGCTTTTATTTATGTAATTAGTTTTGTAAGTAGTCTATATTTAATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.30% 17.90% 1.80% 58.99% NA
All Indica  2759 1.40% 11.90% 1.23% 85.54% NA
All Japonica  1512 62.60% 28.30% 2.38% 6.75% NA
Aus  269 0.00% 0.00% 0.00% 100.00% NA
Indica I  595 2.40% 0.20% 0.50% 96.97% NA
Indica II  465 0.90% 3.20% 0.22% 95.70% NA
Indica III  913 0.20% 24.30% 0.33% 75.14% NA
Indica Intermediate  786 2.30% 11.30% 3.44% 82.95% NA
Temperate Japonica  767 90.90% 5.70% 1.96% 1.43% NA
Tropical Japonica  504 29.00% 54.60% 1.98% 14.48% NA
Japonica Intermediate  241 42.70% 45.20% 4.56% 7.47% NA
VI/Aromatic  96 1.00% 69.80% 7.29% 21.88% NA
Intermediate  90 25.60% 25.60% 8.89% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139835584 A -> DEL N N silent_mutation Average:34.492; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0139835584 A -> C LOC_Os01g68570.1 upstream_gene_variant ; 4129.0bp to feature; MODIFIER silent_mutation Average:34.492; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0139835584 A -> C LOC_Os01g68580.1 upstream_gene_variant ; 1055.0bp to feature; MODIFIER silent_mutation Average:34.492; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0139835584 A -> C LOC_Os01g68589.1 upstream_gene_variant ; 3631.0bp to feature; MODIFIER silent_mutation Average:34.492; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N
vg0139835584 A -> C LOC_Os01g68570-LOC_Os01g68580 intergenic_region ; MODIFIER silent_mutation Average:34.492; most accessible tissue: Zhenshan97 root, score: 64.819 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139835584 NA 2.95E-06 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 1.50E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 8.31E-07 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 7.68E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 3.18E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 1.57E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 9.95E-08 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 2.80E-07 mr1194_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 2.67E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 7.88E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 1.91E-08 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 1.71E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 2.60E-06 2.60E-06 mr1466_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 5.76E-06 mr1555_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 3.95E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 1.94E-06 mr1736_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 1.57E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 1.69E-09 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139835584 NA 2.62E-07 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251