Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0139829148:

Variant ID: vg0139829148 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 39829148
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.08, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

GCCTATACATTTGTCGACAAAATTTTCACCAAAAAATTGACAGATGTAATTATAATATAATCGTAGTGTAATTACACTATAACTTATATGTAACTACACT[G/A]
TAACTTACATGTAACTACAGTGTAACTTATATGTAAGTGTCACATAATTTTGAATCGTTAGATCTATTACACGATTTGTTTTGGTGAGGAAGAAAACAAA

Reverse complement sequence

TTTGTTTTCTTCCTCACCAAAACAAATCGTGTAATAGATCTAACGATTCAAAATTATGTGACACTTACATATAAGTTACACTGTAGTTACATGTAAGTTA[C/T]
AGTGTAGTTACATATAAGTTATAGTGTAATTACACTACGATTATATTATAATTACATCTGTCAATTTTTTGGTGAAAATTTTGTCGACAAATGTATAGGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.00%	31.40%	1.38%	1.23%	NA
All Indica	2759	92.00%	5.80%	0.76%	1.52%	NA
All Japonica	1512	20.40%	75.80%	2.71%	1.06%	NA
Aus	269	52.80%	47.20%	0.00%	0.00%	NA
Indica I	595	95.10%	2.40%	1.85%	0.67%	NA
Indica II	465	98.90%	0.90%	0.00%	0.22%	NA
Indica III	913	87.40%	8.50%	0.44%	3.61%	NA
Indica Intermediate	786	90.70%	8.00%	0.76%	0.51%	NA
Temperate Japonica	767	3.00%	97.00%	0.00%	0.00%	NA
Tropical Japonica	504	33.50%	55.80%	7.94%	2.78%	NA
Japonica Intermediate	241	48.50%	50.20%	0.41%	0.83%	NA
VI/Aromatic	96	79.20%	19.80%	1.04%	0.00%	NA
Intermediate	90	58.90%	38.90%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0139829148	G -> A	LOC_Os01g68545.1	upstream_gene_variant ; 2440.0bp to feature; MODIFIER	silent_mutation	Average:42.561; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0139829148	G -> A	LOC_Os01g68560.1	upstream_gene_variant ; 416.0bp to feature; MODIFIER	silent_mutation	Average:42.561; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0139829148	G -> A	LOC_Os01g68570.1	downstream_gene_variant ; 560.0bp to feature; MODIFIER	silent_mutation	Average:42.561; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0139829148	G -> A	LOC_Os01g68560-LOC_Os01g68570	intergenic_region ; MODIFIER	silent_mutation	Average:42.561; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N
vg0139829148	G -> DEL	N	N	silent_mutation	Average:42.561; most accessible tissue: Zhenshan97 panicle, score: 78.302	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0139829148	G	A	-0.01	-0.01	-0.01	0.0	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0139829148	NA	4.14E-07	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139829148	NA	3.21E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139829148	NA	1.74E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139829148	NA	2.34E-06	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139829148	4.30E-07	4.30E-07	mr1065_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139829148	NA	2.27E-07	mr1091_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139829148	4.68E-06	5.04E-08	mr1096_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139829148	NA	5.09E-06	mr1222_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139829148	NA	2.96E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139829148	NA	6.67E-06	mr1519_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139829148	NA	1.16E-06	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251