\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0139800351:

Variant ID: vg0139800351 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 39800351
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGAACACTATGCAACGCAGGCAGGATTGTGACGTGCCACATGTAGTTTAGCGGTTGCATTGACTTAAGTAGCATATTCATGATAGCAAATTTTAGATTG[G/A]
GTTAGGCTAAATTTATAATTTAAAAATATTGCATATATCCGGTCGGATGTAGAGGCCGATAAAAAATACCCTTCTCTAAGAAAAGATCGTGATGTGCCCT

Reverse complement sequence

AGGGCACATCACGATCTTTTCTTAGAGAAGGGTATTTTTTATCGGCCTCTACATCCGACCGGATATATGCAATATTTTTAAATTATAAATTTAGCCTAAC[C/T]
CAATCTAAAATTTGCTATCATGAATATGCTACTTAAGTCAATGCAACCGCTAAACTACATGTGGCACGTCACAATCCTGCCTGCGTTGCATAGTGTTCTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 30.90% 0.02% 0.00% NA
All Indica  2759 92.00% 8.00% 0.00% 0.00% NA
All Japonica  1512 21.40% 78.60% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 91.30% 8.70% 0.00% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 91.30% 8.70% 0.00% 0.00% NA
Indica Intermediate  786 89.80% 10.20% 0.00% 0.00% NA
Temperate Japonica  767 3.70% 96.30% 0.00% 0.00% NA
Tropical Japonica  504 34.10% 65.90% 0.00% 0.00% NA
Japonica Intermediate  241 51.00% 49.00% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 58.90% 40.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139800351 G -> A LOC_Os01g68490.1 upstream_gene_variant ; 1010.0bp to feature; MODIFIER silent_mutation Average:95.44; most accessible tissue: Zhenshan97 panicle, score: 98.038 N N N N
vg0139800351 G -> A LOC_Os01g68480.1 downstream_gene_variant ; 4540.0bp to feature; MODIFIER silent_mutation Average:95.44; most accessible tissue: Zhenshan97 panicle, score: 98.038 N N N N
vg0139800351 G -> A LOC_Os01g68500.1 downstream_gene_variant ; 1111.0bp to feature; MODIFIER silent_mutation Average:95.44; most accessible tissue: Zhenshan97 panicle, score: 98.038 N N N N
vg0139800351 G -> A LOC_Os01g68490-LOC_Os01g68500 intergenic_region ; MODIFIER silent_mutation Average:95.44; most accessible tissue: Zhenshan97 panicle, score: 98.038 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0139800351 G A -0.05 -0.01 0.0 -0.04 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139800351 NA 7.04E-06 Awn_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0139800351 NA 4.88E-14 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139800351 4.24E-06 4.24E-06 mr1065_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139800351 NA 4.90E-07 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139800351 NA 7.38E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139800351 1.22E-06 NA mr1096_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139800351 NA 3.11E-07 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139800351 NA 5.58E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139800351 NA 2.72E-12 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139800351 NA 7.75E-06 mr1519_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139800351 NA 3.26E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251