\
| Variant ID: vg0139788105 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 39788105 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, T: 0.01, others allele: 0.00, population size: 80. )
TCAATACGGAAAAAATATCATTGAAACGAGTCCATGCTCACGAGGCATCGAAGCTTACAAGGTGTCGGTTGTTAAGAAAAGACCATCTAAAACACATGAC[G/A]
AGATAAATTAATTAACAGGCCTATAAAGGAGTAGAGTGGTGGCGGTTGGTACGACATATAAAAATTGTTAATAAAACACCAAATTGAATCCTAATAATGA
TCATTATTAGGATTCAATTTGGTGTTTTATTAACAATTTTTATATGTCGTACCAACCGCCACCACTCTACTCCTTTATAGGCCTGTTAATTAATTTATCT[C/T]
GTCATGTGTTTTAGATGGTCTTTTCTTAACAACCGACACCTTGTAAGCTTCGATGCCTCGTGAGCATGGACTCGTTTCAATGATATTTTTTCCGTATTGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.20% | 28.70% | 0.15% | 1.90% | NA |
| All Indica | 2759 | 61.20% | 38.20% | 0.14% | 0.43% | NA |
| All Japonica | 1512 | 77.70% | 18.00% | 0.20% | 4.10% | NA |
| Aus | 269 | 97.40% | 0.00% | 0.00% | 2.60% | NA |
| Indica I | 595 | 86.20% | 13.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 8.40% | 91.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 72.70% | 26.10% | 0.22% | 0.99% | NA |
| Indica Intermediate | 786 | 60.20% | 39.30% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 97.50% | 2.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 57.30% | 31.00% | 0.20% | 11.51% | NA |
| Japonica Intermediate | 241 | 57.30% | 41.10% | 0.00% | 1.66% | NA |
| VI/Aromatic | 96 | 80.20% | 12.50% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 75.60% | 22.20% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0139788105 | G -> A | LOC_Os01g68460.1 | upstream_gene_variant ; 4760.0bp to feature; MODIFIER | silent_mutation | Average:34.311; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0139788105 | G -> A | LOC_Os01g68470.1 | upstream_gene_variant ; 1548.0bp to feature; MODIFIER | silent_mutation | Average:34.311; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0139788105 | G -> A | LOC_Os01g68460-LOC_Os01g68470 | intergenic_region ; MODIFIER | silent_mutation | Average:34.311; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg0139788105 | G -> DEL | N | N | silent_mutation | Average:34.311; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0139788105 | NA | 2.56E-21 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0139788105 | NA | 1.16E-23 | Plant_height | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0139788105 | NA | 7.90E-06 | mr1021 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.11E-07 | mr1030 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 8.99E-08 | mr1042 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.36E-08 | mr1043 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.42E-06 | mr1050 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.73E-11 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 6.20E-07 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.81E-09 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.10E-12 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 3.00E-07 | mr1163 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.12E-12 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.17E-06 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 7.95E-07 | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 9.11E-06 | mr1192 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.42E-08 | mr1192 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 8.40E-06 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 3.75E-06 | mr1268 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.95E-08 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.12E-06 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.18E-06 | mr1324 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.16E-06 | mr1335 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.24E-07 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.51E-06 | mr1477 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.72E-09 | mr1479 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.13E-07 | mr1502 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 8.21E-07 | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 7.63E-13 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 6.31E-06 | mr1543 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.73E-06 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 3.10E-07 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.84E-06 | mr1614 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.47E-10 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.44E-06 | mr1621 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.92E-07 | mr1660 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 9.41E-08 | mr1666 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 3.89E-11 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 6.46E-06 | mr1677 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 8.09E-07 | mr1698 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 9.29E-08 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.41E-08 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 8.67E-06 | mr1749 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 3.46E-10 | mr1794 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 7.29E-08 | mr1794 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.91E-06 | mr1872 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.08E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 7.58E-07 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.05E-08 | mr1912 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.18E-06 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 7.34E-13 | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.43E-09 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.11E-11 | mr1969 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 7.29E-07 | mr1975 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.93E-12 | mr1995 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 9.54E-06 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | 2.91E-06 | 2.91E-06 | mr1065_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.64E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.65E-06 | mr1094_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.14E-07 | mr1096_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.78E-09 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.38E-08 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.68E-08 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.04E-10 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.91E-06 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 3.72E-09 | mr1265_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.76E-08 | mr1268_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.56E-08 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.83E-08 | mr1296_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.23E-06 | mr1323_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.72E-15 | mr1327_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 9.12E-18 | mr1327_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 3.12E-12 | mr1330_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.44E-13 | mr1330_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.61E-22 | mr1352_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.51E-13 | mr1352_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.84E-07 | mr1355_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 6.93E-08 | mr1360_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.98E-09 | mr1360_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 3.15E-07 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.01E-06 | mr1439_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.00E-06 | mr1452_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.69E-09 | mr1454_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 3.02E-07 | mr1478_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 3.01E-09 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 6.73E-12 | mr1627_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 3.89E-12 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.97E-13 | mr1794_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.85E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.90E-06 | mr1882_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.03E-07 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 1.02E-07 | mr1899_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.08E-06 | mr1928_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.58E-07 | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 5.07E-08 | mr1929_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.35E-06 | mr1931_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 2.74E-09 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 9.43E-08 | mr1971_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 6.88E-06 | mr1977_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.98E-07 | mr1994_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0139788105 | NA | 4.16E-06 | mr1996_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |