Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0139762608:

Variant ID: vg0139762608 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 39762608
Reference Allele: TAlternative Allele: C,TGTAAAACCGC
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCCCACAAACAATTTTTTAATTCTAATGACACGAAAGCGCCACGTAGAATGAAAATCGGGTTAGCACCGCCACGTCAGCAAAACCGTCCTGTAAAACCG[T/C,TGTAAAACCGC]
TGGAGGAGTCAAATTGCACTAGTTTCAATAATTCGGGGAGTCATCCTATCCGGTGTTTCAGTTAATGGTCACCAATTAGATTTGGTAAACAATTAAGGGA

Reverse complement sequence

TCCCTTAATTGTTTACCAAATCTAATTGGTGACCATTAACTGAAACACCGGATAGGATGACTCCCCGAATTATTGAAACTAGTGCAATTTGACTCCTCCA[A/G,GCGGTTTTACA]
CGGTTTTACAGGACGGTTTTGCTGACGTGGCGGTGCTAACCCGATTTTCATTCTACGTGGCGCTTTCGTGTCATTAGAATTAAAAAATTGTTTGTGGGAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.60% 20.20% 0.85% 1.29% TGTAAAACCGC: 0.02%
All Indica  2759 98.30% 1.20% 0.51% 0.00% NA
All Japonica  1512 36.00% 59.50% 0.53% 3.97% NA
Aus  269 97.40% 0.00% 2.60% 0.00% NA
Indica I  595 97.80% 2.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.90% 0.00% 1.10% 0.00% NA
Indica Intermediate  786 96.90% 2.70% 0.38% 0.00% NA
Temperate Japonica  767 3.40% 96.30% 0.26% 0.00% NA
Tropical Japonica  504 75.80% 12.30% 0.40% 11.51% NA
Japonica Intermediate  241 56.40% 41.10% 1.66% 0.83% NA
VI/Aromatic  96 90.60% 1.00% 7.29% 0.00% TGTAAAACCGC: 1.04%
Intermediate  90 71.10% 23.30% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0139762608 T -> TGTAAAACCGC LOC_Os01g68420.1 upstream_gene_variant ; 287.0bp to feature; MODIFIER silent_mutation Average:99.019; most accessible tissue: Zhenshan97 flower, score: 99.773 N N N N
vg0139762608 T -> TGTAAAACCGC LOC_Os01g68430.1 upstream_gene_variant ; 3710.0bp to feature; MODIFIER silent_mutation Average:99.019; most accessible tissue: Zhenshan97 flower, score: 99.773 N N N N
vg0139762608 T -> TGTAAAACCGC LOC_Os01g68410-LOC_Os01g68420 intergenic_region ; MODIFIER silent_mutation Average:99.019; most accessible tissue: Zhenshan97 flower, score: 99.773 N N N N
vg0139762608 T -> DEL N N silent_mutation Average:99.019; most accessible tissue: Zhenshan97 flower, score: 99.773 N N N N
vg0139762608 T -> C LOC_Os01g68420.1 upstream_gene_variant ; 288.0bp to feature; MODIFIER silent_mutation Average:99.019; most accessible tissue: Zhenshan97 flower, score: 99.773 N N N N
vg0139762608 T -> C LOC_Os01g68430.1 upstream_gene_variant ; 3711.0bp to feature; MODIFIER silent_mutation Average:99.019; most accessible tissue: Zhenshan97 flower, score: 99.773 N N N N
vg0139762608 T -> C LOC_Os01g68410-LOC_Os01g68420 intergenic_region ; MODIFIER silent_mutation Average:99.019; most accessible tissue: Zhenshan97 flower, score: 99.773 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0139762608 T C 0.0 0.01 0.01 0.0 0.0 0.0
vg0139762608 T TGTAA* 0.02 0.07 0.15 0.17 0.13 0.15

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0139762608 NA 2.73E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 7.91E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 8.03E-11 mr1087_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 1.43E-07 mr1090_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 4.57E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 2.67E-08 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 4.22E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 2.46E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 2.00E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 3.30E-06 1.00E-65 mr1241_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 6.72E-51 mr1404_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 7.56E-45 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 1.54E-22 mr1611_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 2.20E-29 mr1789_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 2.56E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 1.93E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 3.45E-12 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0139762608 NA 2.46E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251